Incidental Mutation 'R1186:Ddx5'
ID 102168
Institutional Source Beutler Lab
Gene Symbol Ddx5
Ensembl Gene ENSMUSG00000020719
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
Synonyms Hlr1, p68, 2600009A06Rik
MMRRC Submission 039258-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1186 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 106780355-106789185 bp(-) (GRCm38)
Type of Mutation splice site (1517 bp from exon)
DNA Base Change (assembly) T to C at 106783979 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021060] [ENSMUST00000021062] [ENSMUST00000123339] [ENSMUST00000126201] [ENSMUST00000127061] [ENSMUST00000127481] [ENSMUST00000129585] [ENSMUST00000133426] [ENSMUST00000134029] [ENSMUST00000155107]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021060
SMART Domains Protein: ENSMUSP00000021060
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
SCOP:d1g5ha2 41 330 4e-36 SMART
Pfam:HGTP_anticodon 354 452 3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021062
AA Change: D399G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021062
Gene: ENSMUSG00000020719
AA Change: D399G

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 9e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
HELICc 355 436 3.57e-32 SMART
low complexity region 477 496 N/A INTRINSIC
Pfam:P68HR 498 532 8e-20 PFAM
Pfam:P68HR 551 583 5.2e-20 PFAM
low complexity region 592 603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106779
SMART Domains Protein: ENSMUSP00000102391
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 3e-38 BLAST
PDB:4A4D|A 52 86 4e-17 PDB
Predicted Effect probably null
Transcript: ENSMUST00000123339
SMART Domains Protein: ENSMUSP00000121733
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 7e-37 BLAST
Pfam:DEAD 118 161 1.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126201
SMART Domains Protein: ENSMUSP00000116583
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 134 2e-70 PDB
SCOP:d1g5ha2 41 130 8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127061
SMART Domains Protein: ENSMUSP00000117441
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 170 1e-100 PDB
SCOP:d1g5ha2 41 163 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127481
SMART Domains Protein: ENSMUSP00000138184
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 70 2e-26 BLAST
PDB:4A4D|A 52 70 3e-7 PDB
Predicted Effect probably null
Transcript: ENSMUST00000129585
SMART Domains Protein: ENSMUSP00000116859
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 8e-37 BLAST
Pfam:DEAD 118 183 7.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130172
Predicted Effect probably damaging
Transcript: ENSMUST00000133426
AA Change: D399G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138237
Gene: ENSMUSG00000020719
AA Change: D399G

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 2e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
Pfam:Helicase_C 359 406 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134029
SMART Domains Protein: ENSMUSP00000122755
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175532
Predicted Effect probably benign
Transcript: ENSMUST00000155107
SMART Domains Protein: ENSMUSP00000118975
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Meta Mutation Damage Score 0.9746 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a reporter/null allele die around E11.5 displaying blood vessel malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,621,652 R64Q probably benign Het
4932438A13Rik T C 3: 36,996,312 probably benign Het
9530068E07Rik G A 11: 52,403,078 V49I probably benign Het
A2m T C 6: 121,661,534 S902P probably benign Het
Aatf A T 11: 84,470,549 probably benign Het
Adamtsl1 A G 4: 86,388,509 T1395A probably benign Het
Alpk2 T C 18: 65,294,341 probably null Het
Ank3 G T 10: 69,867,460 A308S probably damaging Het
Arap1 A G 7: 101,404,269 probably benign Het
C4b T C 17: 34,736,309 D769G possibly damaging Het
Cep350 A G 1: 155,875,376 S2017P probably damaging Het
Cfap54 T A 10: 92,875,994 I2704F unknown Het
Crip2 G A 12: 113,144,959 probably benign Het
Cyp4f14 T C 17: 32,916,786 I34V probably benign Het
Dcstamp A G 15: 39,754,629 probably null Het
Dnah2 A T 11: 69,515,700 L572Q probably damaging Het
Espl1 G A 15: 102,304,039 A527T probably benign Het
Fam83d A G 2: 158,785,174 D261G probably damaging Het
Fbxo34 T C 14: 47,530,586 F468L probably damaging Het
Gabarapl1 A T 6: 129,533,405 probably benign Het
Galnt17 G T 5: 131,111,742 T179K probably damaging Het
Gm6768 A C 12: 119,261,471 noncoding transcript Het
Gm6899 C T 11: 26,593,685 probably benign Het
Helz2 T A 2: 181,231,128 R2433W probably damaging Het
Hivep3 T C 4: 119,814,723 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ica1 A G 6: 8,672,326 L225P probably damaging Het
Inpp5f T C 7: 128,694,583 I195T probably benign Het
Isyna1 C A 8: 70,595,201 N115K probably benign Het
Ly6g6e T C 17: 35,078,008 F75S probably benign Het
Ly96 A G 1: 16,700,894 D101G possibly damaging Het
Mapk9 A G 11: 49,878,269 T243A probably damaging Het
Mcc A G 18: 44,759,403 V48A probably benign Het
Mcpt2 C T 14: 56,043,945 probably benign Het
Med24 T C 11: 98,717,757 probably benign Het
Mtbp G A 15: 55,564,671 G162S probably null Het
Mtfr2 G A 10: 20,352,852 C48Y probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Naip2 AGGG AGG 13: 100,162,037 probably null Het
Nup107 A C 10: 117,777,146 Y292* probably null Het
Nwd2 C T 5: 63,650,024 probably benign Het
Nxpe4 A C 9: 48,393,392 N260H probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1084 A T 2: 86,639,463 L82M probably damaging Het
Olfr5 T C 7: 6,480,542 I205V probably benign Het
Olfr901 T C 9: 38,431,101 V273A possibly damaging Het
Olfr911-ps1 T C 9: 38,524,157 S142P probably damaging Het
P2rx7 T C 5: 122,670,451 Y299H probably damaging Het
Per3 T A 4: 151,026,138 E401V probably damaging Het
Rbm34 C A 8: 126,965,447 E182* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Senp2 T C 16: 22,011,504 S38P probably damaging Het
Slc36a2 A T 11: 55,164,231 probably null Het
Spred1 A T 2: 117,177,697 R361S possibly damaging Het
Spry2 A G 14: 105,892,907 C282R probably damaging Het
Srp54b T C 12: 55,255,528 probably benign Het
Taar8c G C 10: 24,101,565 Y116* probably null Het
Tchh C G 3: 93,448,046 R1598G unknown Het
Tex15 A G 8: 33,571,633 M364V probably benign Het
Ttbk1 T C 17: 46,467,131 R662G probably damaging Het
Ttc5 G A 14: 50,767,226 Q374* probably null Het
Usp46 C T 5: 74,002,122 A312T probably benign Het
Vmn1r176 A T 7: 23,835,626 L34Q probably damaging Het
Vmn1r178 A T 7: 23,893,892 R122* probably null Het
Vmn2r6 T A 3: 64,565,067 M78L probably benign Het
Zfp407 A T 18: 84,209,448 I2012N probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zfyve26 G A 12: 79,263,949 L161F probably damaging Het
Other mutations in Ddx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Ddx5 APN 11 106785009 missense probably damaging 0.99
IGL02975:Ddx5 APN 11 106781885 missense probably benign 0.00
IGL03037:Ddx5 APN 11 106782104 missense possibly damaging 0.82
IGL03046:Ddx5 UTSW 11 106785045 missense probably damaging 1.00
R0544:Ddx5 UTSW 11 106782462 unclassified probably benign
R1464:Ddx5 UTSW 11 106784885 missense probably benign 0.00
R1464:Ddx5 UTSW 11 106784885 missense probably benign 0.00
R1839:Ddx5 UTSW 11 106784897 missense probably benign 0.02
R3781:Ddx5 UTSW 11 106784520 missense probably benign 0.00
R3782:Ddx5 UTSW 11 106784520 missense probably benign 0.00
R4968:Ddx5 UTSW 11 106784127 missense probably damaging 1.00
R4973:Ddx5 UTSW 11 106785007 missense possibly damaging 0.94
R4995:Ddx5 UTSW 11 106785236 missense probably damaging 1.00
R5839:Ddx5 UTSW 11 106782206 missense probably damaging 0.97
R6263:Ddx5 UTSW 11 106788313 missense possibly damaging 0.83
R6314:Ddx5 UTSW 11 106788521 unclassified probably benign
R6341:Ddx5 UTSW 11 106785542 splice site probably null
R6707:Ddx5 UTSW 11 106782232 missense probably benign 0.00
R7424:Ddx5 UTSW 11 106782180 missense probably benign 0.12
R7910:Ddx5 UTSW 11 106784435 missense probably damaging 1.00
R8145:Ddx5 UTSW 11 106782085 missense probably benign 0.03
R8849:Ddx5 UTSW 11 106785149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGCAATCATGCAAAGCATGGG -3'
(R):5'- GGAATCATGCGCTGTGATATAGGGG -3'

Sequencing Primer
(F):5'- CAGTGAACTGTGAGGTAACTTCC -3'
(R):5'- CCAGTGACTTGTAGTAGGCTC -3'
Posted On 2014-01-15