Mutagenetix > Incidental Mutations

Incidental Mutation 'R1186:Naip2'

102181

Institutional Source

Beutler Lab

Gene Symbol

Naip2

Ensembl Gene

ENSMUSG00000078945

Gene Name

NLR family, apoptosis inhibitory protein 2

Synonyms

Birc1b, Naip2, Naip-rs6

MMRRC Submission

039258-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R1186 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

100144063-100202092 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

AGGG to AGG at 100162037 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067975] [ENSMUST00000117913] [ENSMUST00000167986]

Predicted Effect

probably null
Transcript: ENSMUST00000067975

SMART Domains

Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945

Domain	Start	End	E-Value	Type
BIR	58	129	7.95e-18	SMART
BIR	157	229	5.31e-37	SMART
BIR	276	347	4.22e-31	SMART
Pfam:NACHT	508	662	1.9e-36	PFAM
low complexity region	954	964	N/A	INTRINSIC
low complexity region	1116	1126	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000117913

SMART Domains

Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945

Domain	Start	End	E-Value	Type
BIR	58	129	7.95e-18	SMART
BIR	157	229	5.31e-37	SMART
BIR	276	347	4.22e-31	SMART
Pfam:NACHT	508	662	1.9e-36	PFAM
low complexity region	954	964	N/A	INTRINSIC
low complexity region	1116	1126	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000167986

SMART Domains

Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945

Domain	Start	End	E-Value	Type
BIR	58	129	7.95e-18	SMART
BIR	157	229	5.31e-37	SMART
BIR	276	347	4.22e-31	SMART
Pfam:NACHT	508	662	8.6e-35	PFAM
low complexity region	954	964	N/A	INTRINSIC
low complexity region	1116	1126	N/A	INTRINSIC

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 95.7%
20x: 90.1%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length; additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	G	A	10: 21,621,652	R64Q	probably benign	Het
4932438A13Rik	T	C	3: 36,996,312		probably benign	Het
9530068E07Rik	G	A	11: 52,403,078	V49I	probably benign	Het
A2m	T	C	6: 121,661,534	S902P	probably benign	Het
Aatf	A	T	11: 84,470,549		probably benign	Het
Adamtsl1	A	G	4: 86,388,509	T1395A	probably benign	Het
Alpk2	T	C	18: 65,294,341		probably null	Het
Ank3	G	T	10: 69,867,460	A308S	probably damaging	Het
Arap1	A	G	7: 101,404,269		probably benign	Het
C4b	T	C	17: 34,736,309	D769G	possibly damaging	Het
Cep350	A	G	1: 155,875,376	S2017P	probably damaging	Het
Cfap54	T	A	10: 92,875,994	I2704F	unknown	Het
Crip2	G	A	12: 113,144,959		probably benign	Het
Cyp4f14	T	C	17: 32,916,786	I34V	probably benign	Het
Dcstamp	A	G	15: 39,754,629		probably null	Het
Ddx5	T	C	11: 106,783,979		probably null	Het
Dnah2	A	T	11: 69,515,700	L572Q	probably damaging	Het
Espl1	G	A	15: 102,304,039	A527T	probably benign	Het
Fam83d	A	G	2: 158,785,174	D261G	probably damaging	Het
Fbxo34	T	C	14: 47,530,586	F468L	probably damaging	Het
Gabarapl1	A	T	6: 129,533,405		probably benign	Het
Galnt17	G	T	5: 131,111,742	T179K	probably damaging	Het
Gm6768	A	C	12: 119,261,471		noncoding transcript	Het
Gm6899	C	T	11: 26,593,685		probably benign	Het
Helz2	T	A	2: 181,231,128	R2433W	probably damaging	Het
Hivep3	T	C	4: 119,814,723		probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ica1	A	G	6: 8,672,326	L225P	probably damaging	Het
Inpp5f	T	C	7: 128,694,583	I195T	probably benign	Het
Isyna1	C	A	8: 70,595,201	N115K	probably benign	Het
Ly6g6e	T	C	17: 35,078,008	F75S	probably benign	Het
Ly96	A	G	1: 16,700,894	D101G	possibly damaging	Het
Mapk9	A	G	11: 49,878,269	T243A	probably damaging	Het
Mcc	A	G	18: 44,759,403	V48A	probably benign	Het
Mcpt2	C	T	14: 56,043,945		probably benign	Het
Med24	T	C	11: 98,717,757		probably benign	Het
Mtbp	G	A	15: 55,564,671	G162S	probably null	Het
Mtfr2	G	A	10: 20,352,852	C48Y	probably benign	Het
Nup107	A	C	10: 117,777,146	Y292*	probably null	Het
Nwd2	C	T	5: 63,650,024		probably benign	Het
Nxpe4	A	C	9: 48,393,392	N260H	probably benign	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1084	A	T	2: 86,639,463	L82M	probably damaging	Het
Olfr5	T	C	7: 6,480,542	I205V	probably benign	Het
Olfr901	T	C	9: 38,431,101	V273A	possibly damaging	Het
Olfr911-ps1	T	C	9: 38,524,157	S142P	probably damaging	Het
P2rx7	T	C	5: 122,670,451	Y299H	probably damaging	Het
Per3	T	A	4: 151,026,138	E401V	probably damaging	Het
Rbm34	C	A	8: 126,965,447	E182*	probably null	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Senp2	T	C	16: 22,011,504	S38P	probably damaging	Het
Slc36a2	A	T	11: 55,164,231		probably null	Het
Spred1	A	T	2: 117,177,697	R361S	possibly damaging	Het
Spry2	A	G	14: 105,892,907	C282R	probably damaging	Het
Srp54b	T	C	12: 55,255,528		probably benign	Het
Taar8c	G	C	10: 24,101,565	Y116*	probably null	Het
Tchh	C	G	3: 93,448,046	R1598G	unknown	Het
Tex15	A	G	8: 33,571,633	M364V	probably benign	Het
Ttbk1	T	C	17: 46,467,131	R662G	probably damaging	Het
Ttc5	G	A	14: 50,767,226	Q374*	probably null	Het
Usp46	C	T	5: 74,002,122	A312T	probably benign	Het
Vmn1r176	A	T	7: 23,835,626	L34Q	probably damaging	Het
Vmn1r178	A	T	7: 23,893,892	R122*	probably null	Het
Vmn2r6	T	A	3: 64,565,067	M78L	probably benign	Het
Zfp407	A	T	18: 84,209,448	I2012N	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het
Zfyve26	G	A	12: 79,263,949	L161F	probably damaging	Het

Other mutations in Naip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Naip2	APN	13	100154887	missense	probably benign	0.00
IGL00676:Naip2	APN	13	100152632	missense	probably damaging	1.00
IGL00870:Naip2	APN	13	100152060	splice site	probably benign
IGL00908:Naip2	APN	13	100160649	missense	probably benign	0.01
IGL00916:Naip2	APN	13	100161431	missense	probably damaging	0.97
IGL00949:Naip2	APN	13	100161591	missense	probably damaging	1.00
IGL01010:Naip2	APN	13	100154938	missense	probably damaging	0.99
IGL01642:Naip2	APN	13	100160937	missense	probably damaging	0.97
IGL01884:Naip2	APN	13	100188821	splice site	probably benign
IGL01917:Naip2	APN	13	100162083	missense	probably benign	0.00
IGL02015:Naip2	APN	13	100161607	missense	possibly damaging	0.57
IGL02315:Naip2	APN	13	100161236	missense	probably damaging	1.00
IGL02328:Naip2	APN	13	100161369	missense	probably damaging	1.00
IGL02735:Naip2	APN	13	100160214	missense	probably damaging	0.99
IGL02738:Naip2	APN	13	100189177	missense	probably benign	0.01
IGL02887:Naip2	APN	13	100161512	missense	possibly damaging	0.90
IGL02894:Naip2	APN	13	100160997	missense	probably damaging	1.00
IGL02894:Naip2	APN	13	100183789	missense	probably benign
IGL02974:Naip2	APN	13	100161678	missense	probably damaging	1.00
IGL03024:Naip2	APN	13	100189354	missense	possibly damaging	0.50
IGL03056:Naip2	APN	13	100162287	missense	possibly damaging	0.90
IGL03281:Naip2	APN	13	100161620	missense	probably damaging	0.99
R0131:Naip2	UTSW	13	100183788	missense	probably benign	0.01
R0131:Naip2	UTSW	13	100183788	missense	probably benign	0.01
R0132:Naip2	UTSW	13	100183788	missense	probably benign	0.01
R0310:Naip2	UTSW	13	100148842	missense	probably damaging	1.00
R0367:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0368:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0422:Naip2	UTSW	13	100161113	missense	probably benign	0.10
R0441:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0445:Naip2	UTSW	13	100161887	missense	possibly damaging	0.91
R0446:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0464:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0466:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0467:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0486:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0533:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R0853:Naip2	UTSW	13	100161854	missense	probably benign
R0853:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0855:Naip2	UTSW	13	100161854	missense	probably benign
R0855:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0904:Naip2	UTSW	13	100161854	missense	probably benign
R0904:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0906:Naip2	UTSW	13	100161854	missense	probably benign
R0906:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0908:Naip2	UTSW	13	100161854	missense	probably benign
R0908:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R0959:Naip2	UTSW	13	100154878	missense	probably benign	0.01
R0959:Naip2	UTSW	13	100154911	missense	probably benign	0.03
R0962:Naip2	UTSW	13	100179385	missense	probably damaging	1.00
R1024:Naip2	UTSW	13	100161854	missense	probably benign
R1024:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1186:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1217:Naip2	UTSW	13	100161854	missense	probably benign
R1217:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1340:Naip2	UTSW	13	100189122	missense	possibly damaging	0.80
R1342:Naip2	UTSW	13	100161854	missense	probably benign
R1342:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1404:Naip2	UTSW	13	100161854	missense	probably benign
R1423:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1423:Naip2	UTSW	13	100154847	intron	probably benign
R1423:Naip2	UTSW	13	100154872	missense	possibly damaging	0.59
R1423:Naip2	UTSW	13	100154878	missense	probably benign	0.01
R1426:Naip2	UTSW	13	100161854	missense	probably benign
R1426:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1472:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1575:Naip2	UTSW	13	100155021	missense	probably benign	0.00
R1575:Naip2	UTSW	13	100155029	intron	probably benign
R1576:Naip2	UTSW	13	100155021	missense	probably benign	0.00
R1576:Naip2	UTSW	13	100155029	intron	probably benign
R1599:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1640:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1641:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1642:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1643:Naip2	UTSW	13	100161981	missense	possibly damaging	0.63
R1644:Naip2	UTSW	13	100182929	missense	possibly damaging	0.83
R1681:Naip2	UTSW	13	100161854	missense	probably benign
R1681:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1891:Naip2	UTSW	13	100154887	missense	probably benign	0.00
R1913:Naip2	UTSW	13	100152157	critical splice acceptor site	probably null
R1937:Naip2	UTSW	13	100161854	missense	probably benign
R1937:Naip2	UTSW	13	100161860	missense	probably benign	0.00
R1993:Naip2	UTSW	13	100162007	missense	probably benign	0.03
R2001:Naip2	UTSW	13	100144588	missense	probably damaging	1.00
R2055:Naip2	UTSW	13	100179372	missense	probably benign	0.07
R2198:Naip2	UTSW	13	100152592	missense	probably damaging	1.00
R2906:Naip2	UTSW	13	100161996	missense	probably damaging	1.00
R2931:Naip2	UTSW	13	100155021	missense	probably benign	0.00
R3014:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R3016:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R3037:Naip2	UTSW	13	100154949	missense	probably benign	0.08
R3414:Naip2	UTSW	13	100189263	nonsense	probably null
R3437:Naip2	UTSW	13	100154911	missense	probably benign	0.03
R3713:Naip2	UTSW	13	100161902	missense	probably damaging	1.00
R3806:Naip2	UTSW	13	100152634	missense	possibly damaging	0.92
R3847:Naip2	UTSW	13	100179432	missense	probably damaging	1.00
R3847:Naip2	UTSW	13	100179433	missense	probably damaging	1.00
R3848:Naip2	UTSW	13	100179432	missense	probably damaging	1.00
R3848:Naip2	UTSW	13	100179433	missense	probably damaging	1.00
R3849:Naip2	UTSW	13	100179432	missense	probably damaging	1.00
R3849:Naip2	UTSW	13	100179433	missense	probably damaging	1.00
R3850:Naip2	UTSW	13	100179432	missense	probably damaging	1.00
R3850:Naip2	UTSW	13	100179433	missense	probably damaging	1.00
R3891:Naip2	UTSW	13	100161098	missense	probably damaging	0.99
R4419:Naip2	UTSW	13	100160625	missense	probably benign	0.03
R4456:Naip2	UTSW	13	100154911	missense	probably benign	0.03
R4458:Naip2	UTSW	13	100154911	missense	probably benign	0.03
R4689:Naip2	UTSW	13	100148812	missense	probably damaging	1.00
R4797:Naip2	UTSW	13	100161735	missense	probably damaging	1.00
R4852:Naip2	UTSW	13	100161536	missense	probably benign
R4922:Naip2	UTSW	13	100154960	missense	probably benign
R5135:Naip2	UTSW	13	100179440	missense	probably damaging	0.98
R5185:Naip2	UTSW	13	100189351	missense	probably damaging	1.00
R5265:Naip2	UTSW	13	100152560	missense	probably damaging	1.00
R5451:Naip2	UTSW	13	100188860	missense	probably benign	0.12
R5521:Naip2	UTSW	13	100154914	missense	probably damaging	1.00
R5737:Naip2	UTSW	13	100161854	missense	probably benign	0.38
R6244:Naip2	UTSW	13	100152137	missense	probably damaging	1.00
R6478:Naip2	UTSW	13	100162041	missense	probably benign
R6480:Naip2	UTSW	13	100162041	missense	probably benign
R6481:Naip2	UTSW	13	100162041	missense	probably benign
R6490:Naip2	UTSW	13	100160685	missense	probably benign
R6653:Naip2	UTSW	13	100152136	missense	probably benign	0.00
R6653:Naip2	UTSW	13	100161844	missense	probably benign
R6768:Naip2	UTSW	13	100178324	nonsense	probably null
R6791:Naip2	UTSW	13	100154960	missense	probably benign
R6793:Naip2	UTSW	13	100154960	missense	probably benign
R6890:Naip2	UTSW	13	100162041	missense	probably benign
R7036:Naip2	UTSW	13	100155021	missense	probably benign	0.00
R7213:Naip2	UTSW	13	100187483	missense	probably damaging	1.00
R7342:Naip2	UTSW	13	100189356	missense	probably benign	0.09
R7445:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R7572:Naip2	UTSW	13	100154960	missense	probably benign
R7699:Naip2	UTSW	13	100160369	missense	probably benign	0.00
R7840:Naip2	UTSW	13	100144409	missense	probably benign	0.14
R7874:Naip2	UTSW	13	100154951	missense	not run
R7874:Naip2	UTSW	13	100154960	missense	probably benign
R8038:Naip2	UTSW	13	100162062	missense	probably benign	0.00
R8065:Naip2	UTSW	13	100189222	missense	probably damaging	1.00
R8094:Naip2	UTSW	13	100161782	missense	probably benign	0.01
R8166:Naip2	UTSW	13	100162007	missense	probably benign	0.03
R8378:Naip2	UTSW	13	100161782	missense	probably benign	0.01
V5622:Naip2	UTSW	13	100155021	missense	probably benign	0.00
V5622:Naip2	UTSW	13	100155021	missense	probably benign	0.00
V5622:Naip2	UTSW	13	100155029	intron	probably benign
X0063:Naip2	UTSW	13	100161758	missense	probably damaging	1.00
Y5405:Naip2	UTSW	13	100154960	missense	probably benign
Z1088:Naip2	UTSW	13	100161909	missense	probably benign
Z1176:Naip2	UTSW	13	100161593	missense	probably benign	0.02
Z1176:Naip2	UTSW	13	100161909	missense	probably benign
Z1177:Naip2	UTSW	13	100152629	missense	possibly damaging	0.65
Z1177:Naip2	UTSW	13	100161909	missense	probably benign
Z1177:Naip2	UTSW	13	100162865	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGGATGATGCTGCTCAGACACAC -3'
(R):5'- AAGCCCAGGAACTTGAACCTGC -3'

Sequencing Primer
(F):5'- TGCTCAGACACACTTCACTAATG -3'
(R):5'- TGCATCCAGTGGGACCTATC -3'

Posted On

2014-01-15