Incidental Mutation 'R1186:Fbxo34'
ID 102182
Institutional Source Beutler Lab
Gene Symbol Fbxo34
Ensembl Gene ENSMUSG00000037536
Gene Name F-box protein 34
Synonyms 5830426G16Rik, 2900057B08Rik
MMRRC Submission 039258-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R1186 (G1)
Quality Score 182
Status Not validated
Chromosome 14
Chromosomal Location 47709992-47769419 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 47768043 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 468 (F468L)
Ref Sequence ENSEMBL: ENSMUSP00000132271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043112] [ENSMUST00000095941] [ENSMUST00000163324] [ENSMUST00000165714] [ENSMUST00000168833] [ENSMUST00000226395] [ENSMUST00000226432] [ENSMUST00000226954] [ENSMUST00000228740] [ENSMUST00000228019] [ENSMUST00000228668]
AlphaFold Q80XI1
Predicted Effect probably damaging
Transcript: ENSMUST00000043112
AA Change: F519L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044675
Gene: ENSMUSG00000037536
AA Change: F519L

DomainStartEndE-ValueType
low complexity region 8 45 N/A INTRINSIC
FBOX 613 653 1.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095941
AA Change: F468L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093634
Gene: ENSMUSG00000037536
AA Change: F468L

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163324
AA Change: F468L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131708
Gene: ENSMUSG00000037536
AA Change: F468L

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165714
AA Change: F468L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130036
Gene: ENSMUSG00000037536
AA Change: F468L

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168833
AA Change: F468L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132271
Gene: ENSMUSG00000037536
AA Change: F468L

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226395
Predicted Effect probably benign
Transcript: ENSMUST00000226432
Predicted Effect probably benign
Transcript: ENSMUST00000226954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227162
Predicted Effect probably benign
Transcript: ENSMUST00000227601
Predicted Effect probably benign
Transcript: ENSMUST00000228740
Predicted Effect probably benign
Transcript: ENSMUST00000228019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228634
Predicted Effect probably benign
Transcript: ENSMUST00000228668
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO34, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,497,551 (GRCm39) R64Q probably benign Het
9530068E07Rik G A 11: 52,293,905 (GRCm39) V49I probably benign Het
A2m T C 6: 121,638,493 (GRCm39) S902P probably benign Het
Aatf A T 11: 84,361,375 (GRCm39) probably benign Het
Adamtsl1 A G 4: 86,306,746 (GRCm39) T1395A probably benign Het
Alpk2 T C 18: 65,427,412 (GRCm39) probably null Het
Ank3 G T 10: 69,703,290 (GRCm39) A308S probably damaging Het
Arap1 A G 7: 101,053,476 (GRCm39) probably benign Het
Bltp1 T C 3: 37,050,461 (GRCm39) probably benign Het
C4b T C 17: 34,955,283 (GRCm39) D769G possibly damaging Het
Cep350 A G 1: 155,751,122 (GRCm39) S2017P probably damaging Het
Cfap54 T A 10: 92,711,856 (GRCm39) I2704F unknown Het
Crip2 G A 12: 113,108,579 (GRCm39) probably benign Het
Cyp4f14 T C 17: 33,135,760 (GRCm39) I34V probably benign Het
Dcstamp A G 15: 39,618,025 (GRCm39) probably null Het
Ddx5 T C 11: 106,674,805 (GRCm39) probably null Het
Dnah2 A T 11: 69,406,526 (GRCm39) L572Q probably damaging Het
Espl1 G A 15: 102,212,474 (GRCm39) A527T probably benign Het
Fam83d A G 2: 158,627,094 (GRCm39) D261G probably damaging Het
Gabarapl1 A T 6: 129,510,368 (GRCm39) probably benign Het
Galnt17 G T 5: 131,140,580 (GRCm39) T179K probably damaging Het
Gm6899 C T 11: 26,543,685 (GRCm39) probably benign Het
Helz2 T A 2: 180,872,921 (GRCm39) R2433W probably damaging Het
Hivep3 T C 4: 119,671,920 (GRCm39) probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ica1 A G 6: 8,672,326 (GRCm39) L225P probably damaging Het
Inpp5f T C 7: 128,296,307 (GRCm39) I195T probably benign Het
Isyna1 C A 8: 71,047,851 (GRCm39) N115K probably benign Het
Ly6g6e T C 17: 35,296,984 (GRCm39) F75S probably benign Het
Ly96 A G 1: 16,771,118 (GRCm39) D101G possibly damaging Het
Mapk9 A G 11: 49,769,096 (GRCm39) T243A probably damaging Het
Mcc A G 18: 44,892,470 (GRCm39) V48A probably benign Het
Mcpt2 C T 14: 56,281,402 (GRCm39) probably benign Het
Med24 T C 11: 98,608,583 (GRCm39) probably benign Het
Mtbp G A 15: 55,428,067 (GRCm39) G162S probably null Het
Mtfr2 G A 10: 20,228,598 (GRCm39) C48Y probably benign Het
Naip2 AGGG AGG 13: 100,298,545 (GRCm39) probably null Het
Naip2 C T 13: 100,298,489 (GRCm39) A516T possibly damaging Het
Ncoa4-ps A C 12: 119,225,206 (GRCm39) noncoding transcript Het
Nup107 A C 10: 117,613,051 (GRCm39) Y292* probably null Het
Nwd2 C T 5: 63,807,367 (GRCm39) probably benign Het
Nxpe4 A C 9: 48,304,692 (GRCm39) N260H probably benign Het
Ofcc1 C T 13: 40,362,305 (GRCm39) G206R probably benign Het
Or6z7 T C 7: 6,483,541 (GRCm39) I205V probably benign Het
Or8b42 T C 9: 38,342,397 (GRCm39) V273A possibly damaging Het
Or8b47 T C 9: 38,435,453 (GRCm39) S142P probably damaging Het
Or8k37 A T 2: 86,469,807 (GRCm39) L82M probably damaging Het
P2rx7 T C 5: 122,808,514 (GRCm39) Y299H probably damaging Het
Per3 T A 4: 151,110,595 (GRCm39) E401V probably damaging Het
Rbm34 C A 8: 127,692,197 (GRCm39) E182* probably null Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Senp2 T C 16: 21,830,254 (GRCm39) S38P probably damaging Het
Slc36a2 A T 11: 55,055,057 (GRCm39) probably null Het
Spred1 A T 2: 117,008,178 (GRCm39) R361S possibly damaging Het
Spry2 A G 14: 106,130,341 (GRCm39) C282R probably damaging Het
Srp54b T C 12: 55,302,313 (GRCm39) probably benign Het
Taar8c G C 10: 23,977,463 (GRCm39) Y116* probably null Het
Tchh C G 3: 93,355,353 (GRCm39) R1598G unknown Het
Tex15 A G 8: 34,061,661 (GRCm39) M364V probably benign Het
Ttbk1 T C 17: 46,778,057 (GRCm39) R662G probably damaging Het
Ttc5 G A 14: 51,004,683 (GRCm39) Q374* probably null Het
Usp46 C T 5: 74,162,783 (GRCm39) A312T probably benign Het
Vmn1r176 A T 7: 23,535,051 (GRCm39) L34Q probably damaging Het
Vmn1r178 A T 7: 23,593,317 (GRCm39) R122* probably null Het
Vmn2r6 T A 3: 64,472,488 (GRCm39) M78L probably benign Het
Zfp407 A T 18: 84,227,573 (GRCm39) I2012N probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Zfyve26 G A 12: 79,310,723 (GRCm39) L161F probably damaging Het
Other mutations in Fbxo34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Fbxo34 APN 14 47,766,931 (GRCm39) missense probably damaging 0.97
IGL01337:Fbxo34 APN 14 47,767,674 (GRCm39) missense probably benign 0.05
IGL01418:Fbxo34 APN 14 47,768,241 (GRCm39) missense possibly damaging 0.46
IGL02069:Fbxo34 APN 14 47,767,070 (GRCm39) missense probably damaging 1.00
IGL02829:Fbxo34 APN 14 47,767,146 (GRCm39) missense probably benign 0.00
R0601:Fbxo34 UTSW 14 47,767,714 (GRCm39) missense probably benign
R0714:Fbxo34 UTSW 14 47,767,486 (GRCm39) missense probably damaging 1.00
R1714:Fbxo34 UTSW 14 47,766,658 (GRCm39) missense probably damaging 1.00
R1842:Fbxo34 UTSW 14 47,768,464 (GRCm39) missense probably damaging 0.98
R2127:Fbxo34 UTSW 14 47,767,563 (GRCm39) missense probably damaging 0.98
R4199:Fbxo34 UTSW 14 47,768,454 (GRCm39) missense probably damaging 1.00
R4649:Fbxo34 UTSW 14 47,767,085 (GRCm39) missense probably damaging 1.00
R4801:Fbxo34 UTSW 14 47,768,326 (GRCm39) missense probably damaging 1.00
R4802:Fbxo34 UTSW 14 47,768,326 (GRCm39) missense probably damaging 1.00
R4906:Fbxo34 UTSW 14 47,766,911 (GRCm39) missense probably benign 0.26
R5475:Fbxo34 UTSW 14 47,766,802 (GRCm39) missense probably benign 0.01
R5888:Fbxo34 UTSW 14 47,767,176 (GRCm39) missense probably damaging 0.98
R6573:Fbxo34 UTSW 14 47,767,124 (GRCm39) missense possibly damaging 0.61
R7236:Fbxo34 UTSW 14 47,767,841 (GRCm39) missense probably benign 0.00
R7257:Fbxo34 UTSW 14 47,738,329 (GRCm39) critical splice donor site probably null
R7381:Fbxo34 UTSW 14 47,767,992 (GRCm39) missense probably benign 0.02
R7515:Fbxo34 UTSW 14 47,767,798 (GRCm39) missense possibly damaging 0.84
R7562:Fbxo34 UTSW 14 47,767,135 (GRCm39) missense probably benign 0.00
R8190:Fbxo34 UTSW 14 47,767,879 (GRCm39) missense possibly damaging 0.67
R9094:Fbxo34 UTSW 14 47,767,928 (GRCm39) missense probably benign 0.00
R9620:Fbxo34 UTSW 14 47,768,725 (GRCm39) missense probably damaging 1.00
R9632:Fbxo34 UTSW 14 47,768,724 (GRCm39) missense probably damaging 1.00
R9710:Fbxo34 UTSW 14 47,768,724 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCTGTCCGTCGCATAAGAAG -3'
(R):5'- CATGTACTGCTGAGGCTCCAGAAG -3'

Sequencing Primer
(F):5'- TCCGTCGCATAAGAAGAGAGC -3'
(R):5'- GAAGCTGCTGGATCTTAAACCTG -3'
Posted On 2014-01-15