Incidental Mutation 'R1186:Spry2'
ID 102188
Institutional Source Beutler Lab
Gene Symbol Spry2
Ensembl Gene ENSMUSG00000022114
Gene Name sprouty RTK signaling antagonist 2
Synonyms sprouty2
MMRRC Submission 039258-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock # R1186 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 105891947-105896819 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105892907 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 282 (C282R)
Ref Sequence ENSEMBL: ENSMUSP00000022709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022709]
AlphaFold Q9QXV8
Predicted Effect probably damaging
Transcript: ENSMUST00000022709
AA Change: C282R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022709
Gene: ENSMUSG00000022114
AA Change: C282R

DomainStartEndE-ValueType
low complexity region 107 130 N/A INTRINSIC
Pfam:Sprouty 183 301 2.8e-38 PFAM
Meta Mutation Damage Score 0.9581 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the sprouty family. The encoded protein contains a carboxyl-terminal cysteine-rich domain essential for the inhibitory activity on receptor tyrosine kinase signaling proteins and is required for growth factor stimulated translocation of the protein to membrane ruffles. In primary dermal endothelial cells this gene is transiently upregulated in response to fibroblast growth factor two. This protein is indirectly involved in the non-cell autonomous inhibitory effect on fibroblast growth factor two signaling. The protein interacts with Cas-Br-M (murine) ectropic retroviral transforming sequence, and can function as a bimodal regulator of epidermal growth factor receptor/mitogen-activated protein kinase signaling. This protein may play a role in alveoli branching during lung development as shown by a similar mouse protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit enteric nerve hyperplasia which led to esophangeal achalasia and intestinal pseudo-obstruction. Mice also have intermediate to severe hearing loss with abnormalities in the organ of Corti and about half die prematurely. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,621,652 R64Q probably benign Het
4932438A13Rik T C 3: 36,996,312 probably benign Het
9530068E07Rik G A 11: 52,403,078 V49I probably benign Het
A2m T C 6: 121,661,534 S902P probably benign Het
Aatf A T 11: 84,470,549 probably benign Het
Adamtsl1 A G 4: 86,388,509 T1395A probably benign Het
Alpk2 T C 18: 65,294,341 probably null Het
Ank3 G T 10: 69,867,460 A308S probably damaging Het
Arap1 A G 7: 101,404,269 probably benign Het
C4b T C 17: 34,736,309 D769G possibly damaging Het
Cep350 A G 1: 155,875,376 S2017P probably damaging Het
Cfap54 T A 10: 92,875,994 I2704F unknown Het
Crip2 G A 12: 113,144,959 probably benign Het
Cyp4f14 T C 17: 32,916,786 I34V probably benign Het
Dcstamp A G 15: 39,754,629 probably null Het
Ddx5 T C 11: 106,783,979 probably null Het
Dnah2 A T 11: 69,515,700 L572Q probably damaging Het
Espl1 G A 15: 102,304,039 A527T probably benign Het
Fam83d A G 2: 158,785,174 D261G probably damaging Het
Fbxo34 T C 14: 47,530,586 F468L probably damaging Het
Gabarapl1 A T 6: 129,533,405 probably benign Het
Galnt17 G T 5: 131,111,742 T179K probably damaging Het
Gm6768 A C 12: 119,261,471 noncoding transcript Het
Gm6899 C T 11: 26,593,685 probably benign Het
Helz2 T A 2: 181,231,128 R2433W probably damaging Het
Hivep3 T C 4: 119,814,723 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ica1 A G 6: 8,672,326 L225P probably damaging Het
Inpp5f T C 7: 128,694,583 I195T probably benign Het
Isyna1 C A 8: 70,595,201 N115K probably benign Het
Ly6g6e T C 17: 35,078,008 F75S probably benign Het
Ly96 A G 1: 16,700,894 D101G possibly damaging Het
Mapk9 A G 11: 49,878,269 T243A probably damaging Het
Mcc A G 18: 44,759,403 V48A probably benign Het
Mcpt2 C T 14: 56,043,945 probably benign Het
Med24 T C 11: 98,717,757 probably benign Het
Mtbp G A 15: 55,564,671 G162S probably null Het
Mtfr2 G A 10: 20,352,852 C48Y probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Naip2 AGGG AGG 13: 100,162,037 probably null Het
Nup107 A C 10: 117,777,146 Y292* probably null Het
Nwd2 C T 5: 63,650,024 probably benign Het
Nxpe4 A C 9: 48,393,392 N260H probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1084 A T 2: 86,639,463 L82M probably damaging Het
Olfr5 T C 7: 6,480,542 I205V probably benign Het
Olfr901 T C 9: 38,431,101 V273A possibly damaging Het
Olfr911-ps1 T C 9: 38,524,157 S142P probably damaging Het
P2rx7 T C 5: 122,670,451 Y299H probably damaging Het
Per3 T A 4: 151,026,138 E401V probably damaging Het
Rbm34 C A 8: 126,965,447 E182* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Senp2 T C 16: 22,011,504 S38P probably damaging Het
Slc36a2 A T 11: 55,164,231 probably null Het
Spred1 A T 2: 117,177,697 R361S possibly damaging Het
Srp54b T C 12: 55,255,528 probably benign Het
Taar8c G C 10: 24,101,565 Y116* probably null Het
Tchh C G 3: 93,448,046 R1598G unknown Het
Tex15 A G 8: 33,571,633 M364V probably benign Het
Ttbk1 T C 17: 46,467,131 R662G probably damaging Het
Ttc5 G A 14: 50,767,226 Q374* probably null Het
Usp46 C T 5: 74,002,122 A312T probably benign Het
Vmn1r176 A T 7: 23,835,626 L34Q probably damaging Het
Vmn1r178 A T 7: 23,893,892 R122* probably null Het
Vmn2r6 T A 3: 64,565,067 M78L probably benign Het
Zfp407 A T 18: 84,209,448 I2012N probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zfyve26 G A 12: 79,263,949 L161F probably damaging Het
Other mutations in Spry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:Spry2 APN 14 105893054 missense probably damaging 1.00
Eagle UTSW 14 105893357 nonsense probably null
Osprey UTSW 14 105892984 missense possibly damaging 0.92
G1citation:Spry2 UTSW 14 105893357 nonsense probably null
R0016:Spry2 UTSW 14 105893297 missense probably benign 0.08
R0594:Spry2 UTSW 14 105893310 missense possibly damaging 0.50
R0843:Spry2 UTSW 14 105893090 missense probably damaging 1.00
R0943:Spry2 UTSW 14 105893587 missense probably damaging 1.00
R4052:Spry2 UTSW 14 105893201 missense probably damaging 1.00
R5355:Spry2 UTSW 14 105893278 missense probably damaging 0.97
R6306:Spry2 UTSW 14 105892984 missense possibly damaging 0.92
R6822:Spry2 UTSW 14 105893357 nonsense probably null
R7347:Spry2 UTSW 14 105893512 missense probably damaging 1.00
R8424:Spry2 UTSW 14 105893402 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGCGGAGCAACAATCCCTATTAC -3'
(R):5'- AGCCACTGAGCAAGGATGATTTGG -3'

Sequencing Primer
(F):5'- ACAATCCCTATTACTGCAATATTCC -3'
(R):5'- ATCTGTGACAAGCAGTGCCTC -3'
Posted On 2014-01-15