Mutagenetix > Incidental Mutation

Incidental Mutation 'R1186:Espl1'

102193

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

039258-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1186 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 102304039 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 527 (A527T)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000064924
AA Change: A527T

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: A527T

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229050
AA Change: A527T

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230120

Meta Mutation Damage Score

0.1203

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 95.7%
20x: 90.1%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	G	A	10: 21,621,652	R64Q	probably benign	Het
4932438A13Rik	T	C	3: 36,996,312		probably benign	Het
9530068E07Rik	G	A	11: 52,403,078	V49I	probably benign	Het
A2m	T	C	6: 121,661,534	S902P	probably benign	Het
Aatf	A	T	11: 84,470,549		probably benign	Het
Adamtsl1	A	G	4: 86,388,509	T1395A	probably benign	Het
Alpk2	T	C	18: 65,294,341		probably null	Het
Ank3	G	T	10: 69,867,460	A308S	probably damaging	Het
Arap1	A	G	7: 101,404,269		probably benign	Het
C4b	T	C	17: 34,736,309	D769G	possibly damaging	Het
Cep350	A	G	1: 155,875,376	S2017P	probably damaging	Het
Cfap54	T	A	10: 92,875,994	I2704F	unknown	Het
Crip2	G	A	12: 113,144,959		probably benign	Het
Cyp4f14	T	C	17: 32,916,786	I34V	probably benign	Het
Dcstamp	A	G	15: 39,754,629		probably null	Het
Ddx5	T	C	11: 106,783,979		probably null	Het
Dnah2	A	T	11: 69,515,700	L572Q	probably damaging	Het
Fam83d	A	G	2: 158,785,174	D261G	probably damaging	Het
Fbxo34	T	C	14: 47,530,586	F468L	probably damaging	Het
Gabarapl1	A	T	6: 129,533,405		probably benign	Het
Galnt17	G	T	5: 131,111,742	T179K	probably damaging	Het
Gm6768	A	C	12: 119,261,471		noncoding transcript	Het
Gm6899	C	T	11: 26,593,685		probably benign	Het
Helz2	T	A	2: 181,231,128	R2433W	probably damaging	Het
Hivep3	T	C	4: 119,814,723		probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ica1	A	G	6: 8,672,326	L225P	probably damaging	Het
Inpp5f	T	C	7: 128,694,583	I195T	probably benign	Het
Isyna1	C	A	8: 70,595,201	N115K	probably benign	Het
Ly6g6e	T	C	17: 35,078,008	F75S	probably benign	Het
Ly96	A	G	1: 16,700,894	D101G	possibly damaging	Het
Mapk9	A	G	11: 49,878,269	T243A	probably damaging	Het
Mcc	A	G	18: 44,759,403	V48A	probably benign	Het
Mcpt2	C	T	14: 56,043,945		probably benign	Het
Med24	T	C	11: 98,717,757		probably benign	Het
Mtbp	G	A	15: 55,564,671	G162S	probably null	Het
Mtfr2	G	A	10: 20,352,852	C48Y	probably benign	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Naip2	AGGG	AGG	13: 100,162,037		probably null	Het
Nup107	A	C	10: 117,777,146	Y292*	probably null	Het
Nwd2	C	T	5: 63,650,024		probably benign	Het
Nxpe4	A	C	9: 48,393,392	N260H	probably benign	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1084	A	T	2: 86,639,463	L82M	probably damaging	Het
Olfr5	T	C	7: 6,480,542	I205V	probably benign	Het
Olfr901	T	C	9: 38,431,101	V273A	possibly damaging	Het
Olfr911-ps1	T	C	9: 38,524,157	S142P	probably damaging	Het
P2rx7	T	C	5: 122,670,451	Y299H	probably damaging	Het
Per3	T	A	4: 151,026,138	E401V	probably damaging	Het
Rbm34	C	A	8: 126,965,447	E182*	probably null	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Senp2	T	C	16: 22,011,504	S38P	probably damaging	Het
Slc36a2	A	T	11: 55,164,231		probably null	Het
Spred1	A	T	2: 117,177,697	R361S	possibly damaging	Het
Spry2	A	G	14: 105,892,907	C282R	probably damaging	Het
Srp54b	T	C	12: 55,255,528		probably benign	Het
Taar8c	G	C	10: 24,101,565	Y116*	probably null	Het
Tchh	C	G	3: 93,448,046	R1598G	unknown	Het
Tex15	A	G	8: 33,571,633	M364V	probably benign	Het
Ttbk1	T	C	17: 46,467,131	R662G	probably damaging	Het
Ttc5	G	A	14: 50,767,226	Q374*	probably null	Het
Usp46	C	T	5: 74,002,122	A312T	probably benign	Het
Vmn1r176	A	T	7: 23,835,626	L34Q	probably damaging	Het
Vmn1r178	A	T	7: 23,893,892	R122*	probably null	Het
Vmn2r6	T	A	3: 64,565,067	M78L	probably benign	Het
Zfp407	A	T	18: 84,209,448	I2012N	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het
Zfyve26	G	A	12: 79,263,949	L161F	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGACTGACTGCTTGCTCGCTG -3'
(R):5'- GACCACTGTGTGCCTTATACCCAG -3'

Sequencing Primer
(F):5'- GCTTGCTCGCTGTGCTG -3'
(R):5'- ggaaggcagaggcagaag -3'

Posted On

2014-01-15