Incidental Mutation 'R1186:Espl1'
ID 102193
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 039258-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1186 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 102212474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 527 (A527T)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably benign
Transcript: ENSMUST00000064924
AA Change: A527T

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: A527T

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229050
AA Change: A527T

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230120
Meta Mutation Damage Score 0.1203 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,497,551 (GRCm39) R64Q probably benign Het
9530068E07Rik G A 11: 52,293,905 (GRCm39) V49I probably benign Het
A2m T C 6: 121,638,493 (GRCm39) S902P probably benign Het
Aatf A T 11: 84,361,375 (GRCm39) probably benign Het
Adamtsl1 A G 4: 86,306,746 (GRCm39) T1395A probably benign Het
Alpk2 T C 18: 65,427,412 (GRCm39) probably null Het
Ank3 G T 10: 69,703,290 (GRCm39) A308S probably damaging Het
Arap1 A G 7: 101,053,476 (GRCm39) probably benign Het
Bltp1 T C 3: 37,050,461 (GRCm39) probably benign Het
C4b T C 17: 34,955,283 (GRCm39) D769G possibly damaging Het
Cep350 A G 1: 155,751,122 (GRCm39) S2017P probably damaging Het
Cfap54 T A 10: 92,711,856 (GRCm39) I2704F unknown Het
Crip2 G A 12: 113,108,579 (GRCm39) probably benign Het
Cyp4f14 T C 17: 33,135,760 (GRCm39) I34V probably benign Het
Dcstamp A G 15: 39,618,025 (GRCm39) probably null Het
Ddx5 T C 11: 106,674,805 (GRCm39) probably null Het
Dnah2 A T 11: 69,406,526 (GRCm39) L572Q probably damaging Het
Fam83d A G 2: 158,627,094 (GRCm39) D261G probably damaging Het
Fbxo34 T C 14: 47,768,043 (GRCm39) F468L probably damaging Het
Gabarapl1 A T 6: 129,510,368 (GRCm39) probably benign Het
Galnt17 G T 5: 131,140,580 (GRCm39) T179K probably damaging Het
Gm6899 C T 11: 26,543,685 (GRCm39) probably benign Het
Helz2 T A 2: 180,872,921 (GRCm39) R2433W probably damaging Het
Hivep3 T C 4: 119,671,920 (GRCm39) probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ica1 A G 6: 8,672,326 (GRCm39) L225P probably damaging Het
Inpp5f T C 7: 128,296,307 (GRCm39) I195T probably benign Het
Isyna1 C A 8: 71,047,851 (GRCm39) N115K probably benign Het
Ly6g6e T C 17: 35,296,984 (GRCm39) F75S probably benign Het
Ly96 A G 1: 16,771,118 (GRCm39) D101G possibly damaging Het
Mapk9 A G 11: 49,769,096 (GRCm39) T243A probably damaging Het
Mcc A G 18: 44,892,470 (GRCm39) V48A probably benign Het
Mcpt2 C T 14: 56,281,402 (GRCm39) probably benign Het
Med24 T C 11: 98,608,583 (GRCm39) probably benign Het
Mtbp G A 15: 55,428,067 (GRCm39) G162S probably null Het
Mtfr2 G A 10: 20,228,598 (GRCm39) C48Y probably benign Het
Naip2 AGGG AGG 13: 100,298,545 (GRCm39) probably null Het
Naip2 C T 13: 100,298,489 (GRCm39) A516T possibly damaging Het
Ncoa4-ps A C 12: 119,225,206 (GRCm39) noncoding transcript Het
Nup107 A C 10: 117,613,051 (GRCm39) Y292* probably null Het
Nwd2 C T 5: 63,807,367 (GRCm39) probably benign Het
Nxpe4 A C 9: 48,304,692 (GRCm39) N260H probably benign Het
Ofcc1 C T 13: 40,362,305 (GRCm39) G206R probably benign Het
Or6z7 T C 7: 6,483,541 (GRCm39) I205V probably benign Het
Or8b42 T C 9: 38,342,397 (GRCm39) V273A possibly damaging Het
Or8b47 T C 9: 38,435,453 (GRCm39) S142P probably damaging Het
Or8k37 A T 2: 86,469,807 (GRCm39) L82M probably damaging Het
P2rx7 T C 5: 122,808,514 (GRCm39) Y299H probably damaging Het
Per3 T A 4: 151,110,595 (GRCm39) E401V probably damaging Het
Rbm34 C A 8: 127,692,197 (GRCm39) E182* probably null Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Senp2 T C 16: 21,830,254 (GRCm39) S38P probably damaging Het
Slc36a2 A T 11: 55,055,057 (GRCm39) probably null Het
Spred1 A T 2: 117,008,178 (GRCm39) R361S possibly damaging Het
Spry2 A G 14: 106,130,341 (GRCm39) C282R probably damaging Het
Srp54b T C 12: 55,302,313 (GRCm39) probably benign Het
Taar8c G C 10: 23,977,463 (GRCm39) Y116* probably null Het
Tchh C G 3: 93,355,353 (GRCm39) R1598G unknown Het
Tex15 A G 8: 34,061,661 (GRCm39) M364V probably benign Het
Ttbk1 T C 17: 46,778,057 (GRCm39) R662G probably damaging Het
Ttc5 G A 14: 51,004,683 (GRCm39) Q374* probably null Het
Usp46 C T 5: 74,162,783 (GRCm39) A312T probably benign Het
Vmn1r176 A T 7: 23,535,051 (GRCm39) L34Q probably damaging Het
Vmn1r178 A T 7: 23,593,317 (GRCm39) R122* probably null Het
Vmn2r6 T A 3: 64,472,488 (GRCm39) M78L probably benign Het
Zfp407 A T 18: 84,227,573 (GRCm39) I2012N probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Zfyve26 G A 12: 79,310,723 (GRCm39) L161F probably damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACTGACTGCTTGCTCGCTG -3'
(R):5'- GACCACTGTGTGCCTTATACCCAG -3'

Sequencing Primer
(F):5'- GCTTGCTCGCTGTGCTG -3'
(R):5'- ggaaggcagaggcagaag -3'
Posted On 2014-01-15