Incidental Mutation 'R1186:Senp2'
ID 102195
Institutional Source Beutler Lab
Gene Symbol Senp2
Ensembl Gene ENSMUSG00000022855
Gene Name SUMO/sentrin specific peptidase 2
Synonyms 4930538C18Rik, 2310007L05Rik
MMRRC Submission 039258-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1186 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 22009484-22049269 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22011504 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 38 (S38P)
Ref Sequence ENSEMBL: ENSMUSP00000156326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023561] [ENSMUST00000231632] [ENSMUST00000231724] [ENSMUST00000232534] [ENSMUST00000232679]
AlphaFold Q91ZX6
Predicted Effect probably damaging
Transcript: ENSMUST00000023561
AA Change: S38P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023561
Gene: ENSMUSG00000022855
AA Change: S38P

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 101 118 N/A INTRINSIC
low complexity region 325 340 N/A INTRINSIC
Pfam:Peptidase_C48 408 587 1.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231408
Predicted Effect probably benign
Transcript: ENSMUST00000231632
Predicted Effect probably damaging
Transcript: ENSMUST00000231724
AA Change: S38P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000231798
Predicted Effect probably damaging
Transcript: ENSMUST00000232534
AA Change: S29P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000232679
AA Change: S38P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.0657 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SUMO1 (UBL1; MIM 601912) is a small ubiquitin-like protein that can be covalently conjugated to other proteins. SENP2 is one of a group of enzymes that process newly synthesized SUMO1 into the conjugatable form and catalyze the deconjugation of SUMO1-containing species.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous null mice are embryonic lethal due to placental defects resulting from abnormal trophoblast maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,621,652 R64Q probably benign Het
4932438A13Rik T C 3: 36,996,312 probably benign Het
9530068E07Rik G A 11: 52,403,078 V49I probably benign Het
A2m T C 6: 121,661,534 S902P probably benign Het
Aatf A T 11: 84,470,549 probably benign Het
Adamtsl1 A G 4: 86,388,509 T1395A probably benign Het
Alpk2 T C 18: 65,294,341 probably null Het
Ank3 G T 10: 69,867,460 A308S probably damaging Het
Arap1 A G 7: 101,404,269 probably benign Het
C4b T C 17: 34,736,309 D769G possibly damaging Het
Cep350 A G 1: 155,875,376 S2017P probably damaging Het
Cfap54 T A 10: 92,875,994 I2704F unknown Het
Crip2 G A 12: 113,144,959 probably benign Het
Cyp4f14 T C 17: 32,916,786 I34V probably benign Het
Dcstamp A G 15: 39,754,629 probably null Het
Ddx5 T C 11: 106,783,979 probably null Het
Dnah2 A T 11: 69,515,700 L572Q probably damaging Het
Espl1 G A 15: 102,304,039 A527T probably benign Het
Fam83d A G 2: 158,785,174 D261G probably damaging Het
Fbxo34 T C 14: 47,530,586 F468L probably damaging Het
Gabarapl1 A T 6: 129,533,405 probably benign Het
Galnt17 G T 5: 131,111,742 T179K probably damaging Het
Gm6768 A C 12: 119,261,471 noncoding transcript Het
Gm6899 C T 11: 26,593,685 probably benign Het
Helz2 T A 2: 181,231,128 R2433W probably damaging Het
Hivep3 T C 4: 119,814,723 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ica1 A G 6: 8,672,326 L225P probably damaging Het
Inpp5f T C 7: 128,694,583 I195T probably benign Het
Isyna1 C A 8: 70,595,201 N115K probably benign Het
Ly6g6e T C 17: 35,078,008 F75S probably benign Het
Ly96 A G 1: 16,700,894 D101G possibly damaging Het
Mapk9 A G 11: 49,878,269 T243A probably damaging Het
Mcc A G 18: 44,759,403 V48A probably benign Het
Mcpt2 C T 14: 56,043,945 probably benign Het
Med24 T C 11: 98,717,757 probably benign Het
Mtbp G A 15: 55,564,671 G162S probably null Het
Mtfr2 G A 10: 20,352,852 C48Y probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Naip2 AGGG AGG 13: 100,162,037 probably null Het
Nup107 A C 10: 117,777,146 Y292* probably null Het
Nwd2 C T 5: 63,650,024 probably benign Het
Nxpe4 A C 9: 48,393,392 N260H probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1084 A T 2: 86,639,463 L82M probably damaging Het
Olfr5 T C 7: 6,480,542 I205V probably benign Het
Olfr901 T C 9: 38,431,101 V273A possibly damaging Het
Olfr911-ps1 T C 9: 38,524,157 S142P probably damaging Het
P2rx7 T C 5: 122,670,451 Y299H probably damaging Het
Per3 T A 4: 151,026,138 E401V probably damaging Het
Rbm34 C A 8: 126,965,447 E182* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Slc36a2 A T 11: 55,164,231 probably null Het
Spred1 A T 2: 117,177,697 R361S possibly damaging Het
Spry2 A G 14: 105,892,907 C282R probably damaging Het
Srp54b T C 12: 55,255,528 probably benign Het
Taar8c G C 10: 24,101,565 Y116* probably null Het
Tchh C G 3: 93,448,046 R1598G unknown Het
Tex15 A G 8: 33,571,633 M364V probably benign Het
Ttbk1 T C 17: 46,467,131 R662G probably damaging Het
Ttc5 G A 14: 50,767,226 Q374* probably null Het
Usp46 C T 5: 74,002,122 A312T probably benign Het
Vmn1r176 A T 7: 23,835,626 L34Q probably damaging Het
Vmn1r178 A T 7: 23,893,892 R122* probably null Het
Vmn2r6 T A 3: 64,565,067 M78L probably benign Het
Zfp407 A T 18: 84,209,448 I2012N probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zfyve26 G A 12: 79,263,949 L161F probably damaging Het
Other mutations in Senp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Senp2 APN 16 22018364 missense probably damaging 1.00
IGL01562:Senp2 APN 16 22009687 missense probably damaging 1.00
IGL01757:Senp2 APN 16 22009664 missense probably benign 0.13
IGL02593:Senp2 APN 16 22044271 missense probably damaging 1.00
IGL02896:Senp2 APN 16 22018368 nonsense probably null
IGL03219:Senp2 APN 16 22014264 splice site probably benign
IGL03244:Senp2 APN 16 22040579 missense probably damaging 0.97
Jessie UTSW 16 22018364 missense probably damaging 1.00
wrangler UTSW 16 22028594 critical splice donor site probably null
wrestler UTSW 16 22038622 missense probably damaging 1.00
PIT1430001:Senp2 UTSW 16 22014114 splice site probably benign
R0410:Senp2 UTSW 16 22009694 missense probably damaging 0.99
R0511:Senp2 UTSW 16 22036570 missense probably benign 0.01
R1689:Senp2 UTSW 16 22026666 missense probably damaging 0.98
R1723:Senp2 UTSW 16 22028042 missense probably benign 0.00
R1776:Senp2 UTSW 16 22043060 splice site probably benign
R2056:Senp2 UTSW 16 22014199 missense probably damaging 1.00
R2058:Senp2 UTSW 16 22014199 missense probably damaging 1.00
R2371:Senp2 UTSW 16 22018375 missense possibly damaging 0.86
R3838:Senp2 UTSW 16 22009735 missense probably damaging 0.99
R3839:Senp2 UTSW 16 22009735 missense probably damaging 0.99
R4001:Senp2 UTSW 16 22028568 missense possibly damaging 0.95
R4190:Senp2 UTSW 16 22046667 missense probably damaging 1.00
R4191:Senp2 UTSW 16 22046667 missense probably damaging 1.00
R4193:Senp2 UTSW 16 22046667 missense probably damaging 1.00
R4231:Senp2 UTSW 16 22011554 critical splice donor site probably null
R4435:Senp2 UTSW 16 22014241 missense possibly damaging 0.83
R4847:Senp2 UTSW 16 22038636 missense possibly damaging 0.90
R5207:Senp2 UTSW 16 22041380 missense possibly damaging 0.52
R5509:Senp2 UTSW 16 22040522 missense probably damaging 1.00
R6036:Senp2 UTSW 16 22028558 nonsense probably null
R6036:Senp2 UTSW 16 22028558 nonsense probably null
R6475:Senp2 UTSW 16 22023800 missense probably damaging 1.00
R6517:Senp2 UTSW 16 22026724 missense possibly damaging 0.95
R6923:Senp2 UTSW 16 22011576 intron probably benign
R7287:Senp2 UTSW 16 22018364 missense probably damaging 1.00
R7747:Senp2 UTSW 16 22038622 missense probably damaging 1.00
R7884:Senp2 UTSW 16 22014231 missense probably benign 0.39
R8037:Senp2 UTSW 16 22014138 nonsense probably null
R8393:Senp2 UTSW 16 22032114 missense probably damaging 0.99
R8805:Senp2 UTSW 16 22028039 missense probably benign
R9216:Senp2 UTSW 16 22028594 critical splice donor site probably null
R9426:Senp2 UTSW 16 22009741 missense probably damaging 0.98
R9479:Senp2 UTSW 16 22023648 missense probably damaging 0.99
R9592:Senp2 UTSW 16 22026685 missense not run
Z1177:Senp2 UTSW 16 22009705 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GCCAGTGTCCCAAAACCAAATGATG -3'
(R):5'- GGGTTCACTCAGCCAGATGAATCAG -3'

Sequencing Primer
(F):5'- TTTACGACTACATGGGGCAC -3'
(R):5'- taggaaagacaatggcatagagaaag -3'
Posted On 2014-01-15