Incidental Mutation 'R1143:Car13'
ID102196
Institutional Source Beutler Lab
Gene Symbol Car13
Ensembl Gene ENSMUSG00000027555
Gene Namecarbonic anhydrase 13
Synonyms2310075C21Rik
MMRRC Submission 039216-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1143 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location14641727-14663002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14656268 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 164 (I164V)
Ref Sequence ENSEMBL: ENSMUSP00000029071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029071]
Predicted Effect probably benign
Transcript: ENSMUST00000029071
AA Change: I164V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029071
Gene: ENSMUSG00000027555
AA Change: I164V

DomainStartEndE-ValueType
Carb_anhydrase 6 261 1.91e-139 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a family of zinc metalloenzymes. For background information on the CA family, see MIM 114800.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A C 12: 8,012,354 D3612A probably benign Het
Bcr G A 10: 75,061,365 E114K probably benign Het
Dner C T 1: 84,445,464 A473T probably damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gm7247 T C 14: 51,523,418 V148A probably benign Het
Htr1a T C 13: 105,445,068 V272A probably benign Het
Lmnb2 CGCTGCTGCTGCTGCTGCT CGCTGCTGCTGCTGCT 10: 80,904,315 probably benign Het
Myh15 A G 16: 49,065,086 H108R probably benign Het
Skint2 T A 4: 112,625,936 N179K probably benign Het
Smarcad1 G A 6: 65,096,694 R645H probably benign Het
Tbc1d5 G A 17: 50,742,059 Q690* probably null Het
Vmn1r28 T C 6: 58,265,742 V190A probably benign Het
Zfhx3 T A 8: 108,794,411 C722S probably damaging Het
Other mutations in Car13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Car13 APN 3 14656904 splice site probably benign
IGL01894:Car13 APN 3 14661465 missense probably damaging 1.00
IGL03124:Car13 APN 3 14656940 missense possibly damaging 0.75
R0374:Car13 UTSW 3 14656297 splice site probably benign
R0396:Car13 UTSW 3 14656239 missense probably benign
R1087:Car13 UTSW 3 14641825 nonsense probably null
R1566:Car13 UTSW 3 14650698 missense probably benign 0.03
R1769:Car13 UTSW 3 14650735 missense probably benign
R1896:Car13 UTSW 3 14645175 missense probably benign 0.00
R4757:Car13 UTSW 3 14661555 missense probably damaging 1.00
R5645:Car13 UTSW 3 14645120 missense possibly damaging 0.89
R5699:Car13 UTSW 3 14650689 missense probably damaging 1.00
R5810:Car13 UTSW 3 14641768 utr 5 prime probably null
R7161:Car13 UTSW 3 14645208 missense probably benign
R7794:Car13 UTSW 3 14654888 missense probably damaging 1.00
RF002:Car13 UTSW 3 14654914 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCCAGTCTGGTTCTATATGCCAC -3'
(R):5'- TGCAGTCTGGGTCTGTTAAGTTGAAAC -3'

Sequencing Primer
(F):5'- ctgacaccctcttatgttctcc -3'
(R):5'- GTCTGTTAAGTTGAAACTTGCTTC -3'
Posted On2014-01-15