Incidental Mutation 'R1186:C4b'
ID 102199
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement C4B (Chido blood group)
Synonyms Ss, C4
MMRRC Submission 039258-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1186 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34947354-34962856 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34955283 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 769 (D769G)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect possibly damaging
Transcript: ENSMUST00000069507
AA Change: D769G

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: D769G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Meta Mutation Damage Score 0.0910 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,497,551 (GRCm39) R64Q probably benign Het
9530068E07Rik G A 11: 52,293,905 (GRCm39) V49I probably benign Het
A2m T C 6: 121,638,493 (GRCm39) S902P probably benign Het
Aatf A T 11: 84,361,375 (GRCm39) probably benign Het
Adamtsl1 A G 4: 86,306,746 (GRCm39) T1395A probably benign Het
Alpk2 T C 18: 65,427,412 (GRCm39) probably null Het
Ank3 G T 10: 69,703,290 (GRCm39) A308S probably damaging Het
Arap1 A G 7: 101,053,476 (GRCm39) probably benign Het
Bltp1 T C 3: 37,050,461 (GRCm39) probably benign Het
Cep350 A G 1: 155,751,122 (GRCm39) S2017P probably damaging Het
Cfap54 T A 10: 92,711,856 (GRCm39) I2704F unknown Het
Crip2 G A 12: 113,108,579 (GRCm39) probably benign Het
Cyp4f14 T C 17: 33,135,760 (GRCm39) I34V probably benign Het
Dcstamp A G 15: 39,618,025 (GRCm39) probably null Het
Ddx5 T C 11: 106,674,805 (GRCm39) probably null Het
Dnah2 A T 11: 69,406,526 (GRCm39) L572Q probably damaging Het
Espl1 G A 15: 102,212,474 (GRCm39) A527T probably benign Het
Fam83d A G 2: 158,627,094 (GRCm39) D261G probably damaging Het
Fbxo34 T C 14: 47,768,043 (GRCm39) F468L probably damaging Het
Gabarapl1 A T 6: 129,510,368 (GRCm39) probably benign Het
Galnt17 G T 5: 131,140,580 (GRCm39) T179K probably damaging Het
Gm6899 C T 11: 26,543,685 (GRCm39) probably benign Het
Helz2 T A 2: 180,872,921 (GRCm39) R2433W probably damaging Het
Hivep3 T C 4: 119,671,920 (GRCm39) probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ica1 A G 6: 8,672,326 (GRCm39) L225P probably damaging Het
Inpp5f T C 7: 128,296,307 (GRCm39) I195T probably benign Het
Isyna1 C A 8: 71,047,851 (GRCm39) N115K probably benign Het
Ly6g6e T C 17: 35,296,984 (GRCm39) F75S probably benign Het
Ly96 A G 1: 16,771,118 (GRCm39) D101G possibly damaging Het
Mapk9 A G 11: 49,769,096 (GRCm39) T243A probably damaging Het
Mcc A G 18: 44,892,470 (GRCm39) V48A probably benign Het
Mcpt2 C T 14: 56,281,402 (GRCm39) probably benign Het
Med24 T C 11: 98,608,583 (GRCm39) probably benign Het
Mtbp G A 15: 55,428,067 (GRCm39) G162S probably null Het
Mtfr2 G A 10: 20,228,598 (GRCm39) C48Y probably benign Het
Naip2 AGGG AGG 13: 100,298,545 (GRCm39) probably null Het
Naip2 C T 13: 100,298,489 (GRCm39) A516T possibly damaging Het
Ncoa4-ps A C 12: 119,225,206 (GRCm39) noncoding transcript Het
Nup107 A C 10: 117,613,051 (GRCm39) Y292* probably null Het
Nwd2 C T 5: 63,807,367 (GRCm39) probably benign Het
Nxpe4 A C 9: 48,304,692 (GRCm39) N260H probably benign Het
Ofcc1 C T 13: 40,362,305 (GRCm39) G206R probably benign Het
Or6z7 T C 7: 6,483,541 (GRCm39) I205V probably benign Het
Or8b42 T C 9: 38,342,397 (GRCm39) V273A possibly damaging Het
Or8b47 T C 9: 38,435,453 (GRCm39) S142P probably damaging Het
Or8k37 A T 2: 86,469,807 (GRCm39) L82M probably damaging Het
P2rx7 T C 5: 122,808,514 (GRCm39) Y299H probably damaging Het
Per3 T A 4: 151,110,595 (GRCm39) E401V probably damaging Het
Rbm34 C A 8: 127,692,197 (GRCm39) E182* probably null Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Senp2 T C 16: 21,830,254 (GRCm39) S38P probably damaging Het
Slc36a2 A T 11: 55,055,057 (GRCm39) probably null Het
Spred1 A T 2: 117,008,178 (GRCm39) R361S possibly damaging Het
Spry2 A G 14: 106,130,341 (GRCm39) C282R probably damaging Het
Srp54b T C 12: 55,302,313 (GRCm39) probably benign Het
Taar8c G C 10: 23,977,463 (GRCm39) Y116* probably null Het
Tchh C G 3: 93,355,353 (GRCm39) R1598G unknown Het
Tex15 A G 8: 34,061,661 (GRCm39) M364V probably benign Het
Ttbk1 T C 17: 46,778,057 (GRCm39) R662G probably damaging Het
Ttc5 G A 14: 51,004,683 (GRCm39) Q374* probably null Het
Usp46 C T 5: 74,162,783 (GRCm39) A312T probably benign Het
Vmn1r176 A T 7: 23,535,051 (GRCm39) L34Q probably damaging Het
Vmn1r178 A T 7: 23,593,317 (GRCm39) R122* probably null Het
Vmn2r6 T A 3: 64,472,488 (GRCm39) M78L probably benign Het
Zfp407 A T 18: 84,227,573 (GRCm39) I2012N probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Zfyve26 G A 12: 79,310,723 (GRCm39) L161F probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34,953,402 (GRCm39) missense probably damaging 1.00
IGL00433:C4b APN 17 34,961,015 (GRCm39) missense possibly damaging 0.75
IGL00471:C4b APN 17 34,953,403 (GRCm39) missense probably damaging 1.00
IGL00515:C4b APN 17 34,947,865 (GRCm39) missense probably damaging 1.00
IGL01599:C4b APN 17 34,961,993 (GRCm39) splice site probably benign
IGL01761:C4b APN 17 34,958,912 (GRCm39) missense possibly damaging 0.56
IGL02004:C4b APN 17 34,957,984 (GRCm39) unclassified probably benign
IGL02215:C4b APN 17 34,953,465 (GRCm39) missense probably damaging 1.00
IGL02517:C4b APN 17 34,953,382 (GRCm39) missense probably benign 0.01
IGL02926:C4b APN 17 34,949,686 (GRCm39) missense possibly damaging 0.95
IGL03031:C4b APN 17 34,950,104 (GRCm39) missense possibly damaging 0.47
IGL03057:C4b APN 17 34,956,738 (GRCm39) unclassified probably benign
IGL03165:C4b APN 17 34,958,929 (GRCm39) missense probably benign 0.13
IGL03380:C4b APN 17 34,959,260 (GRCm39) missense probably benign 0.01
Aspiration UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
Inspiration UTSW 17 34,951,140 (GRCm39) splice site probably null
Peroration UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
perspiration UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
FR4548:C4b UTSW 17 34,959,971 (GRCm39) missense probably benign 0.00
PIT4142001:C4b UTSW 17 34,952,675 (GRCm39) missense probably benign 0.01
R0064:C4b UTSW 17 34,957,830 (GRCm39) missense probably damaging 1.00
R0113:C4b UTSW 17 34,960,214 (GRCm39) missense probably damaging 0.98
R0143:C4b UTSW 17 34,953,193 (GRCm39) unclassified probably benign
R0254:C4b UTSW 17 34,953,750 (GRCm39) missense probably benign 0.00
R0320:C4b UTSW 17 34,952,135 (GRCm39) missense probably benign 0.01
R0391:C4b UTSW 17 34,954,588 (GRCm39) splice site probably benign
R0399:C4b UTSW 17 34,947,843 (GRCm39) missense probably damaging 1.00
R0467:C4b UTSW 17 34,955,101 (GRCm39) missense probably benign 0.01
R0549:C4b UTSW 17 34,954,389 (GRCm39) missense probably damaging 1.00
R0561:C4b UTSW 17 34,953,391 (GRCm39) missense probably damaging 0.99
R0662:C4b UTSW 17 34,949,862 (GRCm39) missense probably damaging 1.00
R0941:C4b UTSW 17 34,959,029 (GRCm39) missense probably benign
R1161:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1169:C4b UTSW 17 34,961,946 (GRCm39) missense probably benign 0.14
R1310:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1398:C4b UTSW 17 34,949,693 (GRCm39) unclassified probably benign
R1472:C4b UTSW 17 34,962,743 (GRCm39) nonsense probably null
R1496:C4b UTSW 17 34,958,995 (GRCm39) missense probably benign 0.30
R1544:C4b UTSW 17 34,957,941 (GRCm39) missense probably benign 0.13
R1588:C4b UTSW 17 34,959,999 (GRCm39) missense probably benign
R1645:C4b UTSW 17 34,959,571 (GRCm39) missense probably damaging 1.00
R1664:C4b UTSW 17 34,951,952 (GRCm39) missense probably damaging 1.00
R1678:C4b UTSW 17 34,962,624 (GRCm39) missense probably benign 0.05
R1710:C4b UTSW 17 34,962,638 (GRCm39) splice site probably benign
R1713:C4b UTSW 17 34,948,245 (GRCm39) splice site probably benign
R1770:C4b UTSW 17 34,955,901 (GRCm39) missense possibly damaging 0.78
R1859:C4b UTSW 17 34,954,527 (GRCm39) missense probably benign
R1924:C4b UTSW 17 34,948,631 (GRCm39) missense probably damaging 1.00
R2057:C4b UTSW 17 34,947,594 (GRCm39) missense probably damaging 1.00
R2060:C4b UTSW 17 34,955,075 (GRCm39) missense probably damaging 1.00
R2184:C4b UTSW 17 34,956,676 (GRCm39) missense probably benign 0.27
R2306:C4b UTSW 17 34,947,492 (GRCm39) missense probably benign 0.00
R2363:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2365:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2379:C4b UTSW 17 34,954,717 (GRCm39) missense possibly damaging 0.81
R2860:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R2861:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R3551:C4b UTSW 17 34,960,846 (GRCm39) missense possibly damaging 0.75
R3765:C4b UTSW 17 34,948,814 (GRCm39) missense probably damaging 0.98
R4157:C4b UTSW 17 34,961,829 (GRCm39) missense probably damaging 1.00
R4299:C4b UTSW 17 34,950,118 (GRCm39) missense possibly damaging 0.52
R4365:C4b UTSW 17 34,953,717 (GRCm39) missense possibly damaging 0.65
R4411:C4b UTSW 17 34,947,838 (GRCm39) missense probably damaging 1.00
R4613:C4b UTSW 17 34,953,525 (GRCm39) missense probably benign 0.12
R4784:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R4790:C4b UTSW 17 34,953,117 (GRCm39) missense probably benign 0.01
R4831:C4b UTSW 17 34,955,864 (GRCm39) splice site probably null
R4879:C4b UTSW 17 34,962,621 (GRCm39) missense probably damaging 0.99
R5036:C4b UTSW 17 34,959,419 (GRCm39) critical splice acceptor site probably null
R5361:C4b UTSW 17 34,960,212 (GRCm39) missense probably benign 0.15
R5384:C4b UTSW 17 34,956,635 (GRCm39) missense possibly damaging 0.89
R5518:C4b UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
R5590:C4b UTSW 17 34,959,309 (GRCm39) missense probably damaging 0.98
R5643:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5644:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5833:C4b UTSW 17 34,949,647 (GRCm39) missense probably damaging 1.00
R5931:C4b UTSW 17 34,948,167 (GRCm39) missense probably damaging 0.99
R6178:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R6209:C4b UTSW 17 34,960,061 (GRCm39) missense possibly damaging 0.93
R6225:C4b UTSW 17 34,957,848 (GRCm39) missense possibly damaging 0.64
R6518:C4b UTSW 17 34,953,179 (GRCm39) missense probably damaging 0.98
R6613:C4b UTSW 17 34,952,539 (GRCm39) missense probably damaging 0.99
R6781:C4b UTSW 17 34,961,928 (GRCm39) missense probably damaging 0.99
R6807:C4b UTSW 17 34,949,930 (GRCm39) missense probably benign 0.17
R6858:C4b UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
R6962:C4b UTSW 17 34,951,140 (GRCm39) splice site probably null
R7068:C4b UTSW 17 34,952,451 (GRCm39) missense probably damaging 1.00
R7081:C4b UTSW 17 34,954,417 (GRCm39) missense probably benign 0.27
R7105:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R7211:C4b UTSW 17 34,954,508 (GRCm39) missense possibly damaging 0.92
R7296:C4b UTSW 17 34,962,633 (GRCm39) missense probably damaging 1.00
R7314:C4b UTSW 17 34,959,330 (GRCm39) missense probably benign
R7330:C4b UTSW 17 34,949,446 (GRCm39) missense probably damaging 1.00
R7397:C4b UTSW 17 34,961,364 (GRCm39) missense possibly damaging 0.80
R7437:C4b UTSW 17 34,953,707 (GRCm39) missense probably benign 0.10
R7490:C4b UTSW 17 34,950,054 (GRCm39) nonsense probably null
R7597:C4b UTSW 17 34,958,649 (GRCm39) missense probably benign
R7633:C4b UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
R7900:C4b UTSW 17 34,958,751 (GRCm39) missense probably benign 0.03
R7910:C4b UTSW 17 34,959,326 (GRCm39) missense probably benign 0.00
R7923:C4b UTSW 17 34,961,354 (GRCm39) missense probably damaging 1.00
R7960:C4b UTSW 17 34,960,252 (GRCm39) splice site probably null
R8420:C4b UTSW 17 34,953,513 (GRCm39) missense probably damaging 0.97
R8467:C4b UTSW 17 34,951,787 (GRCm39) missense possibly damaging 0.51
R8558:C4b UTSW 17 34,955,541 (GRCm39) missense probably damaging 1.00
R8725:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8727:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8853:C4b UTSW 17 34,948,879 (GRCm39) missense possibly damaging 0.91
R8934:C4b UTSW 17 34,951,958 (GRCm39) missense possibly damaging 0.78
R8944:C4b UTSW 17 34,961,913 (GRCm39) missense probably benign 0.00
R8960:C4b UTSW 17 34,952,892 (GRCm39) missense probably damaging 1.00
R8982:C4b UTSW 17 34,953,338 (GRCm39) critical splice donor site probably null
R9104:C4b UTSW 17 34,948,233 (GRCm39) missense probably benign 0.39
R9114:C4b UTSW 17 34,948,404 (GRCm39) missense probably damaging 0.99
R9348:C4b UTSW 17 34,952,159 (GRCm39) missense probably benign 0.01
R9428:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R9533:C4b UTSW 17 34,956,698 (GRCm39) nonsense probably null
R9591:C4b UTSW 17 34,957,929 (GRCm39) missense probably benign 0.00
R9678:C4b UTSW 17 34,960,763 (GRCm39) critical splice donor site probably null
Z1176:C4b UTSW 17 34,950,121 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTGGACAGGCTCACACCATGAATC -3'
(R):5'- TTTGCTGAGGACCTTCGCAGGAAC -3'

Sequencing Primer
(F):5'- TAGAATCAGGAAGCCACACTGTC -3'
(R):5'- TTCGCAGGAACCAGACCAG -3'
Posted On 2014-01-15