Incidental Mutation 'R1143:Smarcad1'
ID 102204
Institutional Source Beutler Lab
Gene Symbol Smarcad1
Ensembl Gene ENSMUSG00000029920
Gene Name SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1
Synonyms Etl1, D6Pas1
MMRRC Submission 039216-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R1143 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 65019577-65093045 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 65073678 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 645 (R645H)
Ref Sequence ENSEMBL: ENSMUSP00000031984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031984] [ENSMUST00000204620]
AlphaFold Q04692
Predicted Effect probably benign
Transcript: ENSMUST00000031984
AA Change: R645H

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000031984
Gene: ENSMUSG00000029920
AA Change: R645H

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
low complexity region 143 156 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 488 682 2.58e-38 SMART
Blast:DEXDc 685 745 4e-16 BLAST
HELICc 879 962 4.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204170
Predicted Effect probably benign
Transcript: ENSMUST00000204620
SMART Domains Protein: ENSMUSP00000144767
Gene: ENSMUSG00000029920

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SNF subfamily of helicase proteins. The encoded protein plays a critical role in the restoration of heterochromatin organization and propagation of epigenetic patterns following DNA replication by mediating histone H3/H4 deacetylation. Mutations in this gene are associated with adermatoglyphia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded growth, impaired fertility, skeletal dysplasias, and peri- and postnatal lethality. Mutant phenotypes are influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(258) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(256)
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A C 12: 8,062,354 (GRCm39) D3612A probably benign Het
Bcr G A 10: 74,897,197 (GRCm39) E114K probably benign Het
Car13 A G 3: 14,721,328 (GRCm39) I164V probably benign Het
Dner C T 1: 84,423,185 (GRCm39) A473T probably damaging Het
Fbxw15 G A 9: 109,387,314 (GRCm39) S227F probably damaging Het
Gm7247 T C 14: 51,760,875 (GRCm39) V148A probably benign Het
Htr1a T C 13: 105,581,576 (GRCm39) V272A probably benign Het
Lmnb2 CGCTGCTGCTGCTGCTGCT CGCTGCTGCTGCTGCT 10: 80,740,149 (GRCm39) probably benign Het
Myh15 A G 16: 48,885,449 (GRCm39) H108R probably benign Het
Skint2 T A 4: 112,483,133 (GRCm39) N179K probably benign Het
Tbc1d5 G A 17: 51,049,087 (GRCm39) Q690* probably null Het
Vmn1r28 T C 6: 58,242,727 (GRCm39) V190A probably benign Het
Zfhx3 T A 8: 109,521,043 (GRCm39) C722S probably damaging Het
Other mutations in Smarcad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Smarcad1 APN 6 65,050,223 (GRCm39) missense probably damaging 1.00
IGL02707:Smarcad1 APN 6 65,029,790 (GRCm39) unclassified probably benign
IGL03006:Smarcad1 APN 6 65,060,873 (GRCm39) missense probably benign 0.01
IGL03131:Smarcad1 APN 6 65,051,937 (GRCm39) missense probably damaging 0.96
IGL03406:Smarcad1 APN 6 65,069,510 (GRCm39) missense probably damaging 0.98
Trollip UTSW 6 65,091,320 (GRCm39) missense probably damaging 1.00
wastrel UTSW 6 65,029,654 (GRCm39) missense probably damaging 1.00
N/A - 293:Smarcad1 UTSW 6 65,051,898 (GRCm39) missense probably benign 0.06
R0020:Smarcad1 UTSW 6 65,060,991 (GRCm39) splice site probably benign
R0452:Smarcad1 UTSW 6 65,051,806 (GRCm39) missense possibly damaging 0.66
R1005:Smarcad1 UTSW 6 65,085,711 (GRCm39) missense probably benign 0.30
R1624:Smarcad1 UTSW 6 65,029,631 (GRCm39) missense probably benign 0.40
R1629:Smarcad1 UTSW 6 65,044,091 (GRCm39) missense probably benign 0.00
R1705:Smarcad1 UTSW 6 65,033,400 (GRCm39) missense probably damaging 1.00
R2000:Smarcad1 UTSW 6 65,050,200 (GRCm39) missense probably damaging 1.00
R2979:Smarcad1 UTSW 6 65,051,995 (GRCm39) missense probably benign 0.00
R3937:Smarcad1 UTSW 6 65,091,320 (GRCm39) missense probably damaging 1.00
R4391:Smarcad1 UTSW 6 65,033,443 (GRCm39) missense probably benign 0.17
R4648:Smarcad1 UTSW 6 65,044,073 (GRCm39) missense probably benign 0.04
R4697:Smarcad1 UTSW 6 65,029,625 (GRCm39) missense probably benign 0.00
R4709:Smarcad1 UTSW 6 65,052,099 (GRCm39) missense probably benign 0.01
R4726:Smarcad1 UTSW 6 65,052,025 (GRCm39) missense probably damaging 1.00
R4776:Smarcad1 UTSW 6 65,075,808 (GRCm39) missense probably null 1.00
R4928:Smarcad1 UTSW 6 65,051,898 (GRCm39) missense probably benign 0.06
R5619:Smarcad1 UTSW 6 65,088,865 (GRCm39) missense probably benign 0.03
R5709:Smarcad1 UTSW 6 65,051,746 (GRCm39) missense probably benign 0.01
R6038:Smarcad1 UTSW 6 65,050,232 (GRCm39) missense possibly damaging 0.91
R6038:Smarcad1 UTSW 6 65,050,232 (GRCm39) missense possibly damaging 0.91
R6220:Smarcad1 UTSW 6 65,091,313 (GRCm39) missense probably benign 0.09
R6302:Smarcad1 UTSW 6 65,052,122 (GRCm39) missense possibly damaging 0.93
R7014:Smarcad1 UTSW 6 65,029,654 (GRCm39) missense probably damaging 1.00
R7149:Smarcad1 UTSW 6 65,029,716 (GRCm39) missense probably benign 0.11
R7378:Smarcad1 UTSW 6 65,087,360 (GRCm39) missense probably benign 0.16
R7569:Smarcad1 UTSW 6 65,029,695 (GRCm39) missense probably benign 0.11
R7626:Smarcad1 UTSW 6 65,073,033 (GRCm39) missense possibly damaging 0.71
R7774:Smarcad1 UTSW 6 65,084,814 (GRCm39) missense probably damaging 1.00
R8079:Smarcad1 UTSW 6 65,029,766 (GRCm39) missense possibly damaging 0.51
R8119:Smarcad1 UTSW 6 65,071,303 (GRCm39) missense probably benign
R8129:Smarcad1 UTSW 6 65,044,078 (GRCm39) missense probably benign 0.09
R8558:Smarcad1 UTSW 6 65,060,908 (GRCm39) missense probably benign 0.09
R8679:Smarcad1 UTSW 6 65,088,865 (GRCm39) missense probably benign 0.03
R8770:Smarcad1 UTSW 6 65,029,718 (GRCm39) missense probably benign
R8795:Smarcad1 UTSW 6 65,049,033 (GRCm39) missense probably benign 0.10
R9104:Smarcad1 UTSW 6 65,075,649 (GRCm39) missense probably benign 0.06
R9133:Smarcad1 UTSW 6 65,049,035 (GRCm39) missense probably damaging 0.99
R9400:Smarcad1 UTSW 6 65,050,214 (GRCm39) missense probably damaging 0.97
R9401:Smarcad1 UTSW 6 65,071,321 (GRCm39) missense probably benign 0.00
R9608:Smarcad1 UTSW 6 65,091,318 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAAGATGCCAGCAGGTTCATGTTC -3'
(R):5'- ACCTCAAAACTCCTGACTACTGGTCAT -3'

Sequencing Primer
(F):5'- CTGCCTGAGGTATAGTAGATGATAG -3'
(R):5'- CCATACTATGGCTGATATGTTCAC -3'
Posted On 2014-01-15