Incidental Mutation 'R1186:Alpk2'
ID102207
Institutional Source Beutler Lab
Gene Symbol Alpk2
Ensembl Gene ENSMUSG00000032845
Gene Namealpha-kinase 2
SynonymsHak
MMRRC Submission 039258-MU
Accession Numbers

Genbank: NM_001037294

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1186 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location65265529-65393888 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 65294341 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]
Predicted Effect probably null
Transcript: ENSMUST00000035548
SMART Domains Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845

DomainStartEndE-ValueType
IGc2 24 94 9.34e-4 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1337 1353 N/A INTRINSIC
IG 1766 1849 2.27e-2 SMART
Alpha_kinase 1879 2098 3.72e-79 SMART
Predicted Effect probably null
Transcript: ENSMUST00000141250
SMART Domains Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845

DomainStartEndE-ValueType
low complexity region 255 267 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
IG 1299 1382 2.27e-2 SMART
Alpha_kinase 1412 1603 2.45e-56 SMART
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,621,652 R64Q probably benign Het
4932438A13Rik T C 3: 36,996,312 probably benign Het
9530068E07Rik G A 11: 52,403,078 V49I probably benign Het
A2m T C 6: 121,661,534 S902P probably benign Het
Aatf A T 11: 84,470,549 probably benign Het
Adamtsl1 A G 4: 86,388,509 T1395A probably benign Het
Ank3 G T 10: 69,867,460 A308S probably damaging Het
Arap1 A G 7: 101,404,269 probably benign Het
C4b T C 17: 34,736,309 D769G possibly damaging Het
Cep350 A G 1: 155,875,376 S2017P probably damaging Het
Cfap54 T A 10: 92,875,994 I2704F unknown Het
Crip2 G A 12: 113,144,959 probably benign Het
Cyp4f14 T C 17: 32,916,786 I34V probably benign Het
Dcstamp A G 15: 39,754,629 probably null Het
Ddx5 T C 11: 106,783,979 probably null Het
Dnah2 A T 11: 69,515,700 L572Q probably damaging Het
Espl1 G A 15: 102,304,039 A527T probably benign Het
Fam83d A G 2: 158,785,174 D261G probably damaging Het
Fbxo34 T C 14: 47,530,586 F468L probably damaging Het
Gabarapl1 A T 6: 129,533,405 probably benign Het
Galnt17 G T 5: 131,111,742 T179K probably damaging Het
Gm6768 A C 12: 119,261,471 noncoding transcript Het
Gm6899 C T 11: 26,593,685 probably benign Het
Helz2 T A 2: 181,231,128 R2433W probably damaging Het
Hivep3 T C 4: 119,814,723 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ica1 A G 6: 8,672,326 L225P probably damaging Het
Inpp5f T C 7: 128,694,583 I195T probably benign Het
Isyna1 C A 8: 70,595,201 N115K probably benign Het
Ly6g6e T C 17: 35,078,008 F75S probably benign Het
Ly96 A G 1: 16,700,894 D101G possibly damaging Het
Mapk9 A G 11: 49,878,269 T243A probably damaging Het
Mcc A G 18: 44,759,403 V48A probably benign Het
Mcpt2 C T 14: 56,043,945 probably benign Het
Med24 T C 11: 98,717,757 probably benign Het
Mtbp G A 15: 55,564,671 G162S probably null Het
Mtfr2 G A 10: 20,352,852 C48Y probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Naip2 AGGG AGG 13: 100,162,037 probably null Het
Nup107 A C 10: 117,777,146 Y292* probably null Het
Nwd2 C T 5: 63,650,024 probably benign Het
Nxpe4 A C 9: 48,393,392 N260H probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1084 A T 2: 86,639,463 L82M probably damaging Het
Olfr5 T C 7: 6,480,542 I205V probably benign Het
Olfr901 T C 9: 38,431,101 V273A possibly damaging Het
Olfr911-ps1 T C 9: 38,524,157 S142P probably damaging Het
P2rx7 T C 5: 122,670,451 Y299H probably damaging Het
Per3 T A 4: 151,026,138 E401V probably damaging Het
Rbm34 C A 8: 126,965,447 E182* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Senp2 T C 16: 22,011,504 S38P probably damaging Het
Slc36a2 A T 11: 55,164,231 probably null Het
Spred1 A T 2: 117,177,697 R361S possibly damaging Het
Spry2 A G 14: 105,892,907 C282R probably damaging Het
Srp54b T C 12: 55,255,528 probably benign Het
Taar8c G C 10: 24,101,565 Y116* probably null Het
Tchh C G 3: 93,448,046 R1598G unknown Het
Tex15 A G 8: 33,571,633 M364V probably benign Het
Ttbk1 T C 17: 46,467,131 R662G probably damaging Het
Ttc5 G A 14: 50,767,226 Q374* probably null Het
Usp46 C T 5: 74,002,122 A312T probably benign Het
Vmn1r176 A T 7: 23,835,626 L34Q probably damaging Het
Vmn1r178 A T 7: 23,893,892 R122* probably null Het
Vmn2r6 T A 3: 64,565,067 M78L probably benign Het
Zfp407 A T 18: 84,209,448 I2012N probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zfyve26 G A 12: 79,263,949 L161F probably damaging Het
Other mutations in Alpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Alpk2 APN 18 65305823 missense probably benign 0.27
IGL00478:Alpk2 APN 18 65307226 nonsense probably null
IGL00898:Alpk2 APN 18 65350573 missense probably benign 0.29
IGL00978:Alpk2 APN 18 65291534 splice site probably benign
IGL01093:Alpk2 APN 18 65349329 missense probably damaging 0.98
IGL01094:Alpk2 APN 18 65306602 missense probably damaging 0.96
IGL01109:Alpk2 APN 18 65307140 missense probably benign 0.09
IGL01370:Alpk2 APN 18 65350591 missense possibly damaging 0.56
IGL01393:Alpk2 APN 18 65307708 missense possibly damaging 0.88
IGL01629:Alpk2 APN 18 65300042 missense probably damaging 1.00
IGL01872:Alpk2 APN 18 65304753 missense probably benign 0.01
IGL01983:Alpk2 APN 18 65350682 missense probably damaging 1.00
IGL02294:Alpk2 APN 18 65306075 missense possibly damaging 0.45
IGL02333:Alpk2 APN 18 65349480 missense probably damaging 0.99
IGL02493:Alpk2 APN 18 65350331 missense probably benign 0.02
IGL02551:Alpk2 APN 18 65372751 missense probably damaging 1.00
IGL02864:Alpk2 APN 18 65307599 missense probably benign 0.12
IGL02901:Alpk2 APN 18 65306411 missense probably benign
IGL02954:Alpk2 APN 18 65306136 missense probably benign
IGL03257:Alpk2 APN 18 65349874 missense probably damaging 0.99
IGL03389:Alpk2 APN 18 65304866 missense possibly damaging 0.92
3-1:Alpk2 UTSW 18 65304888 missense probably damaging 0.99
PIT4131001:Alpk2 UTSW 18 65306379 missense possibly damaging 0.84
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0414:Alpk2 UTSW 18 65306159 missense probably benign 0.04
R0546:Alpk2 UTSW 18 65306717 missense probably benign 0.05
R0628:Alpk2 UTSW 18 65307296 missense possibly damaging 0.94
R0658:Alpk2 UTSW 18 65349487 missense probably damaging 1.00
R0731:Alpk2 UTSW 18 65305390 missense probably damaging 0.98
R0919:Alpk2 UTSW 18 65307473 missense probably benign
R1069:Alpk2 UTSW 18 65305014 missense probably benign 0.25
R1508:Alpk2 UTSW 18 65349305 missense probably damaging 1.00
R1535:Alpk2 UTSW 18 65350204 missense probably benign
R1558:Alpk2 UTSW 18 65350230 missense probably benign
R1600:Alpk2 UTSW 18 65378037 missense probably damaging 0.96
R1664:Alpk2 UTSW 18 65349873 missense probably damaging 0.96
R1672:Alpk2 UTSW 18 65280959 missense probably damaging 1.00
R1829:Alpk2 UTSW 18 65294094 missense possibly damaging 0.75
R2110:Alpk2 UTSW 18 65307080 missense possibly damaging 0.94
R2111:Alpk2 UTSW 18 65349774 missense probably benign
R2113:Alpk2 UTSW 18 65305683 missense probably benign 0.31
R2126:Alpk2 UTSW 18 65350368 nonsense probably null
R2198:Alpk2 UTSW 18 65350184 missense probably benign 0.42
R2227:Alpk2 UTSW 18 65378076 missense probably damaging 1.00
R2245:Alpk2 UTSW 18 65305163 missense probably benign 0.02
R2282:Alpk2 UTSW 18 65307626 missense probably benign
R2421:Alpk2 UTSW 18 65306616 missense probably benign 0.00
R2512:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R3105:Alpk2 UTSW 18 65350210 missense possibly damaging 0.57
R3700:Alpk2 UTSW 18 65305151 missense probably damaging 0.99
R4205:Alpk2 UTSW 18 65305211 missense possibly damaging 0.76
R4239:Alpk2 UTSW 18 65300141 missense probably damaging 1.00
R4353:Alpk2 UTSW 18 65291452 missense possibly damaging 0.73
R4572:Alpk2 UTSW 18 65281004 missense probably damaging 1.00
R4584:Alpk2 UTSW 18 65306964 missense probably damaging 0.99
R4591:Alpk2 UTSW 18 65305823 missense probably benign 0.27
R4595:Alpk2 UTSW 18 65289748 missense probably damaging 1.00
R4648:Alpk2 UTSW 18 65349882 missense probably damaging 0.99
R4815:Alpk2 UTSW 18 65349955 missense probably damaging 1.00
R4828:Alpk2 UTSW 18 65349113 missense probably benign
R4910:Alpk2 UTSW 18 65266286 nonsense probably null
R5042:Alpk2 UTSW 18 65350508 nonsense probably null
R5295:Alpk2 UTSW 18 65305038 missense probably damaging 0.98
R5375:Alpk2 UTSW 18 65372738 missense probably damaging 1.00
R5475:Alpk2 UTSW 18 65307012 missense probably benign 0.16
R5480:Alpk2 UTSW 18 65349908 missense probably damaging 1.00
R5486:Alpk2 UTSW 18 65294354 splice site probably null
R5503:Alpk2 UTSW 18 65306241 missense probably benign 0.00
R5595:Alpk2 UTSW 18 65266248 missense probably damaging 1.00
R5648:Alpk2 UTSW 18 65349917 missense probably damaging 0.96
R5714:Alpk2 UTSW 18 65305461 missense possibly damaging 0.55
R5862:Alpk2 UTSW 18 65307289 missense probably damaging 1.00
R5894:Alpk2 UTSW 18 65281072 missense probably damaging 0.99
R5898:Alpk2 UTSW 18 65307623 missense probably damaging 0.99
R5936:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R6142:Alpk2 UTSW 18 65305385 missense possibly damaging 0.94
R6291:Alpk2 UTSW 18 65305901 missense possibly damaging 0.93
R6339:Alpk2 UTSW 18 65349806 missense probably benign 0.00
R6407:Alpk2 UTSW 18 65289738 missense probably benign 0.22
R6487:Alpk2 UTSW 18 65266183 missense possibly damaging 0.62
R6667:Alpk2 UTSW 18 65307740 missense probably damaging 1.00
R6786:Alpk2 UTSW 18 65306634 missense probably benign
R6833:Alpk2 UTSW 18 65306409 missense probably benign 0.08
R6984:Alpk2 UTSW 18 65305678 missense possibly damaging 0.95
R6999:Alpk2 UTSW 18 65304513 missense probably damaging 0.99
R7157:Alpk2 UTSW 18 65266277 nonsense probably null
R7167:Alpk2 UTSW 18 65306978 missense probably benign 0.40
R7225:Alpk2 UTSW 18 65305199 missense probably benign 0.00
R7409:Alpk2 UTSW 18 65306952 missense probably benign 0.01
R7533:Alpk2 UTSW 18 65304603 missense probably damaging 1.00
R7576:Alpk2 UTSW 18 65306816 missense possibly damaging 0.89
R7589:Alpk2 UTSW 18 65300073 missense probably damaging 1.00
R7598:Alpk2 UTSW 18 65304566 missense probably damaging 1.00
R7664:Alpk2 UTSW 18 65307002 missense probably benign 0.03
R7711:Alpk2 UTSW 18 65306484 missense probably benign
R7722:Alpk2 UTSW 18 65350157 missense probably damaging 1.00
R7783:Alpk2 UTSW 18 65306254 nonsense probably null
R7806:Alpk2 UTSW 18 65349416 missense probably benign
R7953:Alpk2 UTSW 18 65349830 missense probably damaging 1.00
R8024:Alpk2 UTSW 18 65305035 missense probably benign 0.01
R8043:Alpk2 UTSW 18 65349830 missense probably damaging 1.00
R8063:Alpk2 UTSW 18 65350346 missense probably benign 0.15
R8171:Alpk2 UTSW 18 65305983 missense probably benign 0.00
R8280:Alpk2 UTSW 18 65307203 missense probably benign
R8383:Alpk2 UTSW 18 65305398 missense probably benign 0.03
R8414:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
R8791:Alpk2 UTSW 18 65305526 missense probably benign 0.00
R8872:Alpk2 UTSW 18 65280906 missense probably damaging 1.00
X0023:Alpk2 UTSW 18 65291400 missense probably damaging 1.00
X0027:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
X0063:Alpk2 UTSW 18 65307363 missense probably benign
X0064:Alpk2 UTSW 18 65349684 missense probably benign 0.09
Z1176:Alpk2 UTSW 18 65305611 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGATGAGCAGCCGTGAAGCC -3'
(R):5'- TGAGCTATGCTAACAGCAGCTTCC -3'

Sequencing Primer
(F):5'- AAGCCGAGGTTTACCTTCAG -3'
(R):5'- GAAGCTCCTAAAGGCTCCTG -3'
Posted On2014-01-15