Incidental Mutation 'R1143:Htr1a'
ID102215
Institutional Source Beutler Lab
Gene Symbol Htr1a
Ensembl Gene ENSMUSG00000021721
Gene Name5-hydroxytryptamine (serotonin) receptor 1A
Synonyms5-HT1A receptor, Gpcr18
MMRRC Submission 039216-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1143 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location105443639-105448122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105445068 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 272 (V272A)
Ref Sequence ENSEMBL: ENSMUSP00000022235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022235]
Predicted Effect probably benign
Transcript: ENSMUST00000022235
AA Change: V272A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022235
Gene: ENSMUSG00000021721
AA Change: V272A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 45 174 2.7e-5 PFAM
Pfam:7TM_GPCR_Srsx 47 236 8e-8 PFAM
Pfam:7tm_1 53 400 1.3e-88 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor for 5-hydroxytryptamine (serotonin), and belongs to the 5-hydroxytryptamine receptor subfamily. Serotonin has been implicated in a number of physiologic processes and pathologic conditions. Inactivation of this gene in mice results in behavior consistent with an increased anxiety and stress response. Mutation in the promoter of this gene has been associated with menstrual cycle-dependent periodic fevers. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygotes for targeted null mutations show a common phenotype, including augmented anxious-like behavior in the elevated plus-maze, open-field, and novel object tests, reduced immobility in the forced-swim or tail-suspension test, and changes in density of 5-HTT binding in several brain regions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A C 12: 8,012,354 D3612A probably benign Het
Bcr G A 10: 75,061,365 E114K probably benign Het
Car13 A G 3: 14,656,268 I164V probably benign Het
Dner C T 1: 84,445,464 A473T probably damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gm7247 T C 14: 51,523,418 V148A probably benign Het
Lmnb2 CGCTGCTGCTGCTGCTGCT CGCTGCTGCTGCTGCT 10: 80,904,315 probably benign Het
Myh15 A G 16: 49,065,086 H108R probably benign Het
Skint2 T A 4: 112,625,936 N179K probably benign Het
Smarcad1 G A 6: 65,096,694 R645H probably benign Het
Tbc1d5 G A 17: 50,742,059 Q690* probably null Het
Vmn1r28 T C 6: 58,265,742 V190A probably benign Het
Zfhx3 T A 8: 108,794,411 C722S probably damaging Het
Other mutations in Htr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Htr1a APN 13 105445284 missense possibly damaging 0.88
R0578:Htr1a UTSW 13 105445087 missense probably damaging 1.00
R0919:Htr1a UTSW 13 105444836 missense probably damaging 1.00
R0962:Htr1a UTSW 13 105444324 missense probably benign 0.02
R1349:Htr1a UTSW 13 105445366 nonsense probably null
R1550:Htr1a UTSW 13 105445280 missense probably benign 0.09
R2520:Htr1a UTSW 13 105445373 missense probably benign 0.43
R3794:Htr1a UTSW 13 105444344 missense possibly damaging 0.59
R6679:Htr1a UTSW 13 105445428 missense probably damaging 1.00
R6844:Htr1a UTSW 13 105444947 missense possibly damaging 0.94
R7680:Htr1a UTSW 13 105445031 missense probably benign
Z1177:Htr1a UTSW 13 105444876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCAATCACCGACCCTATAGAC -3'
(R):5'- TGCTCTCACAGAAAGGTAGGACCAG -3'

Sequencing Primer
(F):5'- CCCTATAGACTACGTGAACAAGAGG -3'
(R):5'- AAGGTGCCCATGATGATGCC -3'
Posted On2014-01-15