Incidental Mutation 'R1187:Rgl1'
ID102220
Institutional Source Beutler Lab
Gene Symbol Rgl1
Ensembl Gene ENSMUSG00000026482
Gene Nameral guanine nucleotide dissociation stimulator,-like 1
SynonymsRgl
MMRRC Submission 039259-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R1187 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location152516760-152766351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152544433 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 353 (D353G)
Ref Sequence ENSEMBL: ENSMUSP00000027760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859]
PDB Structure
SOLUTION STRUCTURE OF THE RAS-BINDING DOMAIN OF RGL [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000027760
AA Change: D353G

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: D353G

DomainStartEndE-ValueType
RasGEFN 64 196 5.86e-39 SMART
RasGEF 228 502 9.56e-116 SMART
Blast:RasGEF 522 582 6e-8 BLAST
low complexity region 585 596 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
RA 648 735 1.7e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111857
AA Change: D351G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: D351G

DomainStartEndE-ValueType
RasGEFN 62 194 5.86e-39 SMART
RasGEF 226 500 9.56e-116 SMART
Blast:RasGEF 520 580 7e-8 BLAST
low complexity region 583 594 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
RA 646 733 1.7e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111859
AA Change: D388G

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: D388G

DomainStartEndE-ValueType
RasGEFN 99 231 5.86e-39 SMART
RasGEF 263 537 9.56e-116 SMART
Blast:RasGEF 557 617 6e-8 BLAST
low complexity region 620 631 N/A INTRINSIC
low complexity region 662 672 N/A INTRINSIC
RA 683 770 1.7e-25 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,528,981 M4276I probably benign Het
Apol7b A T 15: 77,423,403 F297L possibly damaging Het
C330027C09Rik T A 16: 49,000,293 N132K probably damaging Het
Capsl C T 15: 9,457,721 R9W probably damaging Het
Catsperb T C 12: 101,625,732 V1107A probably benign Het
Clca1 T C 3: 145,009,743 I544M probably benign Het
Cma2 T C 14: 55,972,823 V55A probably benign Het
Col10a1 A T 10: 34,394,838 I269F probably benign Het
Col26a1 G A 5: 136,744,166 H385Y probably damaging Het
Ctdp1 A G 18: 80,449,487 Y598H probably damaging Het
Dnajc1 A G 2: 18,284,709 S296P probably benign Het
Dvl2 A T 11: 70,006,136 T250S probably benign Het
Etv1 A G 12: 38,865,564 Y410C probably damaging Het
Gm38394 G A 1: 133,659,203 T132I probably damaging Het
Krcc1 A T 6: 71,284,628 K215* probably null Het
Lrr1 A T 12: 69,175,022 T313S probably benign Het
Lrrc7 T A 3: 158,160,402 E1234V probably damaging Het
Mepe G A 5: 104,338,248 R418H probably damaging Het
Myrfl G A 10: 116,831,542 T331I probably damaging Het
Nbeal1 T C 1: 60,194,528 W26R probably damaging Het
Nsrp1 G A 11: 77,046,027 P448S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfml2a A G 2: 38,959,813 N514D probably damaging Het
Olfr1390 T G 11: 49,340,590 D19E probably damaging Het
Olfr167 T C 16: 19,515,046 T197A probably benign Het
Pcdhb1 C T 18: 37,265,544 R183C probably damaging Het
Phf14 T G 6: 11,941,496 C41G probably damaging Het
Pkhd1l1 T C 15: 44,498,051 V499A possibly damaging Het
Plcb4 A G 2: 135,968,394 I638V probably benign Het
Ppp4c T A 7: 126,786,200 I296F probably benign Het
Prkdc T C 16: 15,759,746 V2388A probably damaging Het
Rnf19b T G 4: 129,075,567 probably null Het
Ryr3 C T 2: 112,958,176 D190N probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e G A 5: 14,232,084 M411I probably damaging Het
Sgsh A T 11: 119,346,578 Y403* probably null Het
Sh2d7 T A 9: 54,541,187 L164Q probably benign Het
Slfn8 A T 11: 83,003,488 V775E probably damaging Het
Smgc G A 15: 91,860,600 G287S probably damaging Het
Soat1 T A 1: 156,434,175 Y421F probably damaging Het
Sri T C 5: 8,059,416 Y52H probably damaging Het
Stat4 C A 1: 52,076,677 Q259K probably damaging Het
Trpm5 A G 7: 143,074,469 L1023P probably damaging Het
Ush1c T A 7: 46,208,914 N650I probably benign Het
Vmn2r8 G T 5: 108,803,219 S120* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp629 A G 7: 127,610,229 S803P probably benign Het
Zfp629 T C 7: 127,611,887 K250R probably damaging Het
Zfp758 T A 17: 22,375,190 I187N probably benign Het
Zfp85 T A 13: 67,749,716 K79I probably damaging Het
Other mutations in Rgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Rgl1 APN 1 152571617 missense probably benign 0.02
IGL01065:Rgl1 APN 1 152519142 missense probably damaging 1.00
IGL01390:Rgl1 APN 1 152571588 splice site probably benign
IGL01726:Rgl1 APN 1 152519153 missense probably damaging 1.00
IGL01837:Rgl1 APN 1 152549150 missense probably damaging 1.00
IGL02019:Rgl1 APN 1 152528469 splice site probably benign
IGL02369:Rgl1 APN 1 152533606 missense probably damaging 1.00
R0240:Rgl1 UTSW 1 152554424 unclassified probably benign
R0255:Rgl1 UTSW 1 152552596 missense probably damaging 1.00
R0562:Rgl1 UTSW 1 152539945 missense probably damaging 1.00
R0648:Rgl1 UTSW 1 152536265 critical splice donor site probably null
R0734:Rgl1 UTSW 1 152554300 missense probably damaging 0.98
R1522:Rgl1 UTSW 1 152586533 missense probably damaging 1.00
R1595:Rgl1 UTSW 1 152675023 splice site probably benign
R1634:Rgl1 UTSW 1 152524772 missense probably damaging 1.00
R1661:Rgl1 UTSW 1 152533575 missense probably damaging 0.99
R1665:Rgl1 UTSW 1 152533575 missense probably damaging 0.99
R1964:Rgl1 UTSW 1 152549104 missense probably damaging 1.00
R2291:Rgl1 UTSW 1 152536281 missense probably damaging 1.00
R4272:Rgl1 UTSW 1 152536289 missense probably benign 0.13
R4668:Rgl1 UTSW 1 152521371 missense probably damaging 1.00
R4669:Rgl1 UTSW 1 152521371 missense probably damaging 1.00
R4747:Rgl1 UTSW 1 152524699 nonsense probably null
R4830:Rgl1 UTSW 1 152554330 missense probably benign 0.11
R4853:Rgl1 UTSW 1 152557574 missense probably benign 0.07
R4969:Rgl1 UTSW 1 152549062 splice site probably null
R5778:Rgl1 UTSW 1 152552421 missense probably benign 0.05
R5979:Rgl1 UTSW 1 152557493 missense probably damaging 1.00
R6180:Rgl1 UTSW 1 152519172 missense probably damaging 1.00
R6183:Rgl1 UTSW 1 152586570 missense possibly damaging 0.94
R6322:Rgl1 UTSW 1 152552435 missense probably damaging 0.98
R6678:Rgl1 UTSW 1 152524724 missense probably damaging 1.00
R6759:Rgl1 UTSW 1 152533530 missense probably damaging 0.99
R6892:Rgl1 UTSW 1 152539940 missense probably benign 0.00
R7290:Rgl1 UTSW 1 152544395 missense possibly damaging 0.78
R7363:Rgl1 UTSW 1 152519163 missense probably damaging 1.00
R7610:Rgl1 UTSW 1 152552620 missense probably damaging 1.00
R7774:Rgl1 UTSW 1 152554350 missense probably benign
RF005:Rgl1 UTSW 1 152521363 missense probably benign
Z1088:Rgl1 UTSW 1 152675020 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCTCAACTGGGCTTTGAATTTTCTCAC -3'
(R):5'- ACTTGATGCCCCAAGGGAATCATCT -3'

Sequencing Primer
(F):5'- CCCAAGTTTCGCAGATTACG -3'
(R):5'- cacttccatactgctgttcatc -3'
Posted On2014-01-15