Incidental Mutation 'R1187:Krcc1'
ID102254
Institutional Source Beutler Lab
Gene Symbol Krcc1
Ensembl Gene ENSMUSG00000053012
Gene Namelysine-rich coiled-coil 1
Synonyms
MMRRC Submission 039259-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1187 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71271677-71285319 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 71284628 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 215 (K215*)
Ref Sequence ENSEMBL: ENSMUSP00000145416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080949] [ENSMUST00000114188] [ENSMUST00000168700] [ENSMUST00000204436] [ENSMUST00000205123]
Predicted Effect probably null
Transcript: ENSMUST00000080949
AA Change: K215*
SMART Domains Protein: ENSMUSP00000079748
Gene: ENSMUSG00000053012
AA Change: K215*

DomainStartEndE-ValueType
coiled coil region 209 238 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114188
SMART Domains Protein: ENSMUSP00000109826
Gene: ENSMUSG00000055027

DomainStartEndE-ValueType
Pfam:zf-MYND 18 56 5.4e-11 PFAM
SET 76 225 1.53e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168700
AA Change: K215*
SMART Domains Protein: ENSMUSP00000130252
Gene: ENSMUSG00000053012
AA Change: K215*

DomainStartEndE-ValueType
coiled coil region 209 238 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204436
AA Change: K215*
SMART Domains Protein: ENSMUSP00000145416
Gene: ENSMUSG00000053012
AA Change: K215*

DomainStartEndE-ValueType
coiled coil region 209 238 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205123
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,528,981 M4276I probably benign Het
Apol7b A T 15: 77,423,403 F297L possibly damaging Het
C330027C09Rik T A 16: 49,000,293 N132K probably damaging Het
Capsl C T 15: 9,457,721 R9W probably damaging Het
Catsperb T C 12: 101,625,732 V1107A probably benign Het
Clca1 T C 3: 145,009,743 I544M probably benign Het
Cma2 T C 14: 55,972,823 V55A probably benign Het
Col10a1 A T 10: 34,394,838 I269F probably benign Het
Col26a1 G A 5: 136,744,166 H385Y probably damaging Het
Ctdp1 A G 18: 80,449,487 Y598H probably damaging Het
Dnajc1 A G 2: 18,284,709 S296P probably benign Het
Dvl2 A T 11: 70,006,136 T250S probably benign Het
Etv1 A G 12: 38,865,564 Y410C probably damaging Het
Gm38394 G A 1: 133,659,203 T132I probably damaging Het
Lrr1 A T 12: 69,175,022 T313S probably benign Het
Lrrc7 T A 3: 158,160,402 E1234V probably damaging Het
Mepe G A 5: 104,338,248 R418H probably damaging Het
Myrfl G A 10: 116,831,542 T331I probably damaging Het
Nbeal1 T C 1: 60,194,528 W26R probably damaging Het
Nsrp1 G A 11: 77,046,027 P448S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfml2a A G 2: 38,959,813 N514D probably damaging Het
Olfr1390 T G 11: 49,340,590 D19E probably damaging Het
Olfr167 T C 16: 19,515,046 T197A probably benign Het
Pcdhb1 C T 18: 37,265,544 R183C probably damaging Het
Phf14 T G 6: 11,941,496 C41G probably damaging Het
Pkhd1l1 T C 15: 44,498,051 V499A possibly damaging Het
Plcb4 A G 2: 135,968,394 I638V probably benign Het
Ppp4c T A 7: 126,786,200 I296F probably benign Het
Prkdc T C 16: 15,759,746 V2388A probably damaging Het
Rgl1 T C 1: 152,544,433 D353G probably benign Het
Rnf19b T G 4: 129,075,567 probably null Het
Ryr3 C T 2: 112,958,176 D190N probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e G A 5: 14,232,084 M411I probably damaging Het
Sgsh A T 11: 119,346,578 Y403* probably null Het
Sh2d7 T A 9: 54,541,187 L164Q probably benign Het
Slfn8 A T 11: 83,003,488 V775E probably damaging Het
Smgc G A 15: 91,860,600 G287S probably damaging Het
Soat1 T A 1: 156,434,175 Y421F probably damaging Het
Sri T C 5: 8,059,416 Y52H probably damaging Het
Stat4 C A 1: 52,076,677 Q259K probably damaging Het
Trpm5 A G 7: 143,074,469 L1023P probably damaging Het
Ush1c T A 7: 46,208,914 N650I probably benign Het
Vmn2r8 G T 5: 108,803,219 S120* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp629 A G 7: 127,610,229 S803P probably benign Het
Zfp629 T C 7: 127,611,887 K250R probably damaging Het
Zfp758 T A 17: 22,375,190 I187N probably benign Het
Zfp85 T A 13: 67,749,716 K79I probably damaging Het
Other mutations in Krcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01828:Krcc1 APN 6 71284367 missense probably damaging 0.97
IGL02246:Krcc1 APN 6 71284421 missense probably benign 0.31
R4965:Krcc1 UTSW 6 71284637 missense probably damaging 0.98
R6949:Krcc1 UTSW 6 71284151 missense probably benign 0.06
R7107:Krcc1 UTSW 6 71284214 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TAGTTCACAAGCGCCTCTGCTC -3'
(R):5'- AGTCCACTACCACAGCAATTTGGTC -3'

Sequencing Primer
(F):5'- TCGACCCTCAAGTCAGTCATAG -3'
(R):5'- TCTGTCCACATATGCAAGTGAC -3'
Posted On2014-01-15