Incidental Mutation 'R1187:Ush1c'
ID102258
Institutional Source Beutler Lab
Gene Symbol Ush1c
Ensembl Gene ENSMUSG00000030838
Gene NameUSH1 protein network component harmonin
Synonymsharmonin, 2010016F01Rik
MMRRC Submission 039259-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1187 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46195350-46238503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46208914 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 650 (N650I)
Ref Sequence ENSEMBL: ENSMUSP00000009667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009667] [ENSMUST00000078680] [ENSMUST00000143155] [ENSMUST00000154292] [ENSMUST00000176371] [ENSMUST00000177212] [ENSMUST00000222454]
Predicted Effect probably benign
Transcript: ENSMUST00000009667
AA Change: N650I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000009667
Gene: ENSMUSG00000030838
AA Change: N650I

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
low complexity region 846 860 N/A INTRINSIC
low complexity region 899 910 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078680
SMART Domains Protein: ENSMUSP00000077747
Gene: ENSMUSG00000030838

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
PDZ 458 537 1.13e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143155
AA Change: N650I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119676
Gene: ENSMUSG00000030838
AA Change: N650I

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148527
Predicted Effect probably benign
Transcript: ENSMUST00000154292
AA Change: N650I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114494
Gene: ENSMUSG00000030838
AA Change: N650I

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
low complexity region 846 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176371
SMART Domains Protein: ENSMUSP00000134783
Gene: ENSMUSG00000030838

DomainStartEndE-ValueType
PDZ 65 137 3.06e-19 SMART
low complexity region 159 172 N/A INTRINSIC
PDZ 189 261 5.62e-18 SMART
coiled coil region 270 345 N/A INTRINSIC
PDZ 427 506 1.13e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177212
SMART Domains Protein: ENSMUSP00000135734
Gene: ENSMUSG00000030838

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 291 6.13e-10 SMART
low complexity region 313 325 N/A INTRINSIC
low complexity region 339 357 N/A INTRINSIC
PDZ 439 518 1.13e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211426
Predicted Effect probably benign
Transcript: ENSMUST00000222454
AA Change: N650I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions in the assembly of Usher protein complexes. The protein contains PDZ domains, a coiled-coil region with a bipartite nuclear localization signal and a PEST degradation sequence. Defects in this gene are the cause of Usher syndrome type 1C and non-syndromic sensorineural deafness autosomal recessive type 18. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mutations at this locus affect hearing and result in movement anomalies generally associated with vestibular mutants, such as head tossing and circling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,528,981 M4276I probably benign Het
Apol7b A T 15: 77,423,403 F297L possibly damaging Het
C330027C09Rik T A 16: 49,000,293 N132K probably damaging Het
Capsl C T 15: 9,457,721 R9W probably damaging Het
Catsperb T C 12: 101,625,732 V1107A probably benign Het
Clca1 T C 3: 145,009,743 I544M probably benign Het
Cma2 T C 14: 55,972,823 V55A probably benign Het
Col10a1 A T 10: 34,394,838 I269F probably benign Het
Col26a1 G A 5: 136,744,166 H385Y probably damaging Het
Ctdp1 A G 18: 80,449,487 Y598H probably damaging Het
Dnajc1 A G 2: 18,284,709 S296P probably benign Het
Dvl2 A T 11: 70,006,136 T250S probably benign Het
Etv1 A G 12: 38,865,564 Y410C probably damaging Het
Gm38394 G A 1: 133,659,203 T132I probably damaging Het
Krcc1 A T 6: 71,284,628 K215* probably null Het
Lrr1 A T 12: 69,175,022 T313S probably benign Het
Lrrc7 T A 3: 158,160,402 E1234V probably damaging Het
Mepe G A 5: 104,338,248 R418H probably damaging Het
Myrfl G A 10: 116,831,542 T331I probably damaging Het
Nbeal1 T C 1: 60,194,528 W26R probably damaging Het
Nsrp1 G A 11: 77,046,027 P448S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfml2a A G 2: 38,959,813 N514D probably damaging Het
Olfr1390 T G 11: 49,340,590 D19E probably damaging Het
Olfr167 T C 16: 19,515,046 T197A probably benign Het
Pcdhb1 C T 18: 37,265,544 R183C probably damaging Het
Phf14 T G 6: 11,941,496 C41G probably damaging Het
Pkhd1l1 T C 15: 44,498,051 V499A possibly damaging Het
Plcb4 A G 2: 135,968,394 I638V probably benign Het
Ppp4c T A 7: 126,786,200 I296F probably benign Het
Prkdc T C 16: 15,759,746 V2388A probably damaging Het
Rgl1 T C 1: 152,544,433 D353G probably benign Het
Rnf19b T G 4: 129,075,567 probably null Het
Ryr3 C T 2: 112,958,176 D190N probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e G A 5: 14,232,084 M411I probably damaging Het
Sgsh A T 11: 119,346,578 Y403* probably null Het
Sh2d7 T A 9: 54,541,187 L164Q probably benign Het
Slfn8 A T 11: 83,003,488 V775E probably damaging Het
Smgc G A 15: 91,860,600 G287S probably damaging Het
Soat1 T A 1: 156,434,175 Y421F probably damaging Het
Sri T C 5: 8,059,416 Y52H probably damaging Het
Stat4 C A 1: 52,076,677 Q259K probably damaging Het
Trpm5 A G 7: 143,074,469 L1023P probably damaging Het
Vmn2r8 G T 5: 108,803,219 S120* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp629 A G 7: 127,610,229 S803P probably benign Het
Zfp629 T C 7: 127,611,887 K250R probably damaging Het
Zfp758 T A 17: 22,375,190 I187N probably benign Het
Zfp85 T A 13: 67,749,716 K79I probably damaging Het
Other mutations in Ush1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ush1c APN 7 46196770 missense probably benign 0.00
IGL01074:Ush1c APN 7 46225250 splice site probably benign
IGL01099:Ush1c APN 7 46205262 missense probably damaging 0.99
IGL01107:Ush1c APN 7 46209901 missense probably damaging 1.00
IGL01446:Ush1c APN 7 46208956 missense possibly damaging 0.86
IGL02267:Ush1c APN 7 46209298 missense possibly damaging 0.92
IGL02307:Ush1c APN 7 46197188 splice site probably benign
IGL02448:Ush1c APN 7 46209137 missense possibly damaging 0.51
IGL02485:Ush1c APN 7 46229250 missense probably damaging 0.99
IGL02896:Ush1c APN 7 46198415 missense probably benign 0.00
IGL03031:Ush1c APN 7 46224937 splice site probably benign
R0085:Ush1c UTSW 7 46225555 missense probably benign 0.09
R0328:Ush1c UTSW 7 46225448 splice site probably benign
R0574:Ush1c UTSW 7 46196804 missense possibly damaging 0.68
R0600:Ush1c UTSW 7 46224908 missense probably benign 0.00
R1406:Ush1c UTSW 7 46225541 critical splice donor site probably null
R1406:Ush1c UTSW 7 46225541 critical splice donor site probably null
R1716:Ush1c UTSW 7 46195728 missense probably benign 0.18
R1727:Ush1c UTSW 7 46209231 missense probably damaging 1.00
R1822:Ush1c UTSW 7 46209901 missense probably damaging 1.00
R1864:Ush1c UTSW 7 46219392 nonsense probably null
R2000:Ush1c UTSW 7 46221433 missense probably damaging 0.99
R2063:Ush1c UTSW 7 46229481 missense probably damaging 1.00
R2068:Ush1c UTSW 7 46229481 missense probably damaging 1.00
R2944:Ush1c UTSW 7 46200982 missense probably damaging 1.00
R4042:Ush1c UTSW 7 46221528 missense probably damaging 0.97
R4043:Ush1c UTSW 7 46221528 missense probably damaging 0.97
R4108:Ush1c UTSW 7 46198445 missense probably damaging 1.00
R4823:Ush1c UTSW 7 46195733 missense probably benign 0.00
R4862:Ush1c UTSW 7 46229240 missense probably damaging 1.00
R5534:Ush1c UTSW 7 46221423 missense probably damaging 1.00
R5922:Ush1c UTSW 7 46204128 critical splice donor site probably null
R6249:Ush1c UTSW 7 46214959 missense probably damaging 1.00
R6475:Ush1c UTSW 7 46229219 missense probably damaging 0.99
R6485:Ush1c UTSW 7 46209110 missense probably benign
R6667:Ush1c UTSW 7 46225624 missense probably damaging 1.00
R7177:Ush1c UTSW 7 46229219 missense probably damaging 0.99
R7419:Ush1c UTSW 7 46229255 missense probably damaging 1.00
R7424:Ush1c UTSW 7 46225555 missense probably benign 0.09
R7811:Ush1c UTSW 7 46205286 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTCACTGTTGCTTGTTTCATGGC -3'
(R):5'- ACTGACCTGGATGACATCCCCTTG -3'

Sequencing Primer
(F):5'- TGCAGGACAGCACATGAC -3'
(R):5'- ACGTGAGCAGCTCATCCTC -3'
Posted On2014-01-15