Incidental Mutation 'R1187:Zfp629'
ID102263
Institutional Source Beutler Lab
Gene Symbol Zfp629
Ensembl Gene ENSMUSG00000045639
Gene Namezinc finger protein 629
Synonyms
MMRRC Submission 039259-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1187 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127607031-127615797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127610229 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 803 (S803P)
Ref Sequence ENSEMBL: ENSMUSP00000113903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058038] [ENSMUST00000084564] [ENSMUST00000122066] [ENSMUST00000128731] [ENSMUST00000131318] [ENSMUST00000132524] [ENSMUST00000134446] [ENSMUST00000151107] [ENSMUST00000152315]
Predicted Effect probably benign
Transcript: ENSMUST00000058038
AA Change: S803P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053760
Gene: ENSMUSG00000045639
AA Change: S803P

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084564
AA Change: S803P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081612
Gene: ENSMUSG00000045639
AA Change: S803P

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122066
AA Change: S803P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113903
Gene: ENSMUSG00000045639
AA Change: S803P

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128731
SMART Domains Protein: ENSMUSP00000140505
Gene: ENSMUSG00000045639

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131318
SMART Domains Protein: ENSMUSP00000116375
Gene: ENSMUSG00000045639

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132524
Predicted Effect probably benign
Transcript: ENSMUST00000134446
Predicted Effect probably benign
Transcript: ENSMUST00000151107
Predicted Effect probably benign
Transcript: ENSMUST00000152315
SMART Domains Protein: ENSMUSP00000114772
Gene: ENSMUSG00000045639

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 195 1.24e2 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,528,981 M4276I probably benign Het
Apol7b A T 15: 77,423,403 F297L possibly damaging Het
C330027C09Rik T A 16: 49,000,293 N132K probably damaging Het
Capsl C T 15: 9,457,721 R9W probably damaging Het
Catsperb T C 12: 101,625,732 V1107A probably benign Het
Clca1 T C 3: 145,009,743 I544M probably benign Het
Cma2 T C 14: 55,972,823 V55A probably benign Het
Col10a1 A T 10: 34,394,838 I269F probably benign Het
Col26a1 G A 5: 136,744,166 H385Y probably damaging Het
Ctdp1 A G 18: 80,449,487 Y598H probably damaging Het
Dnajc1 A G 2: 18,284,709 S296P probably benign Het
Dvl2 A T 11: 70,006,136 T250S probably benign Het
Etv1 A G 12: 38,865,564 Y410C probably damaging Het
Gm38394 G A 1: 133,659,203 T132I probably damaging Het
Krcc1 A T 6: 71,284,628 K215* probably null Het
Lrr1 A T 12: 69,175,022 T313S probably benign Het
Lrrc7 T A 3: 158,160,402 E1234V probably damaging Het
Mepe G A 5: 104,338,248 R418H probably damaging Het
Myrfl G A 10: 116,831,542 T331I probably damaging Het
Nbeal1 T C 1: 60,194,528 W26R probably damaging Het
Nsrp1 G A 11: 77,046,027 P448S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfml2a A G 2: 38,959,813 N514D probably damaging Het
Olfr1390 T G 11: 49,340,590 D19E probably damaging Het
Olfr167 T C 16: 19,515,046 T197A probably benign Het
Pcdhb1 C T 18: 37,265,544 R183C probably damaging Het
Phf14 T G 6: 11,941,496 C41G probably damaging Het
Pkhd1l1 T C 15: 44,498,051 V499A possibly damaging Het
Plcb4 A G 2: 135,968,394 I638V probably benign Het
Ppp4c T A 7: 126,786,200 I296F probably benign Het
Prkdc T C 16: 15,759,746 V2388A probably damaging Het
Rgl1 T C 1: 152,544,433 D353G probably benign Het
Rnf19b T G 4: 129,075,567 probably null Het
Ryr3 C T 2: 112,958,176 D190N probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e G A 5: 14,232,084 M411I probably damaging Het
Sgsh A T 11: 119,346,578 Y403* probably null Het
Sh2d7 T A 9: 54,541,187 L164Q probably benign Het
Slfn8 A T 11: 83,003,488 V775E probably damaging Het
Smgc G A 15: 91,860,600 G287S probably damaging Het
Soat1 T A 1: 156,434,175 Y421F probably damaging Het
Sri T C 5: 8,059,416 Y52H probably damaging Het
Stat4 C A 1: 52,076,677 Q259K probably damaging Het
Trpm5 A G 7: 143,074,469 L1023P probably damaging Het
Ush1c T A 7: 46,208,914 N650I probably benign Het
Vmn2r8 G T 5: 108,803,219 S120* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp758 T A 17: 22,375,190 I187N probably benign Het
Zfp85 T A 13: 67,749,716 K79I probably damaging Het
Other mutations in Zfp629
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Zfp629 APN 7 127612724 missense probably damaging 0.97
IGL01541:Zfp629 APN 7 127612745 utr 5 prime probably benign
IGL02116:Zfp629 APN 7 127612718 missense probably damaging 1.00
IGL02134:Zfp629 APN 7 127611870 missense probably benign 0.22
IGL02547:Zfp629 APN 7 127611674 unclassified probably null
IGL02858:Zfp629 APN 7 127610312 missense probably damaging 1.00
IGL02867:Zfp629 APN 7 127610031 unclassified probably benign
IGL02889:Zfp629 APN 7 127610031 unclassified probably benign
R6768_Zfp629_044 UTSW 7 127610825 missense probably benign 0.03
R0020:Zfp629 UTSW 7 127611169 missense probably benign 0.02
R0137:Zfp629 UTSW 7 127611686 missense probably damaging 1.00
R0219:Zfp629 UTSW 7 127612083 missense probably damaging 1.00
R1061:Zfp629 UTSW 7 127611989 missense probably damaging 1.00
R1182:Zfp629 UTSW 7 127610102 missense probably damaging 1.00
R1187:Zfp629 UTSW 7 127611887 missense probably damaging 1.00
R1217:Zfp629 UTSW 7 127612744 start gained probably benign
R1507:Zfp629 UTSW 7 127611861 nonsense probably null
R1526:Zfp629 UTSW 7 127610759 missense possibly damaging 0.69
R1622:Zfp629 UTSW 7 127611840 missense probably damaging 1.00
R1704:Zfp629 UTSW 7 127610864 missense probably benign 0.06
R1918:Zfp629 UTSW 7 127612000 missense probably damaging 1.00
R2147:Zfp629 UTSW 7 127610444 missense probably damaging 1.00
R2156:Zfp629 UTSW 7 127612379 missense probably benign 0.00
R2258:Zfp629 UTSW 7 127611791 missense probably damaging 1.00
R2994:Zfp629 UTSW 7 127611056 missense probably damaging 0.99
R3735:Zfp629 UTSW 7 127612778 splice site probably benign
R4287:Zfp629 UTSW 7 127611938 missense probably damaging 1.00
R4610:Zfp629 UTSW 7 127612320 missense probably benign 0.26
R4758:Zfp629 UTSW 7 127610586 missense probably damaging 1.00
R4899:Zfp629 UTSW 7 127611018 missense possibly damaging 0.69
R4922:Zfp629 UTSW 7 127612127 missense probably damaging 1.00
R5414:Zfp629 UTSW 7 127611282 missense probably damaging 0.97
R5772:Zfp629 UTSW 7 127611135 missense probably damaging 1.00
R5907:Zfp629 UTSW 7 127610370 missense probably damaging 1.00
R6768:Zfp629 UTSW 7 127610825 missense probably benign 0.03
R7122:Zfp629 UTSW 7 127611312 missense probably damaging 0.99
R7156:Zfp629 UTSW 7 127612291 nonsense probably null
R7407:Zfp629 UTSW 7 127610243 missense probably benign
R7446:Zfp629 UTSW 7 127611029 missense probably benign 0.00
R7780:Zfp629 UTSW 7 127612429 missense probably benign 0.12
R7871:Zfp629 UTSW 7 127611995 missense probably damaging 1.00
R7954:Zfp629 UTSW 7 127611995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCACCAGACCTACTTCACAGG -3'
(R):5'- AACATCAGCTCACTCACGGGAATG -3'

Sequencing Primer
(F):5'- CTGGGTGACAGCTCCTATG -3'
(R):5'- GCCCTTTAAATGCCCAGAGTG -3'
Posted On2014-01-15