Incidental Mutation 'R1187:Dvl2'
ID102279
Institutional Source Beutler Lab
Gene Symbol Dvl2
Ensembl Gene ENSMUSG00000020888
Gene Namedishevelled segment polarity protein 2
Synonyms
MMRRC Submission 039259-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R1187 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70000595-70012301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70006136 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 250 (T250S)
Ref Sequence ENSEMBL: ENSMUSP00000140073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018718] [ENSMUST00000019362] [ENSMUST00000102574] [ENSMUST00000102575] [ENSMUST00000190940]
Predicted Effect probably benign
Transcript: ENSMUST00000018718
SMART Domains Protein: ENSMUSP00000018718
Gene: ENSMUSG00000018574

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 74 188 4.4e-22 PFAM
Pfam:Acyl-CoA_dh_M 192 245 5.1e-20 PFAM
Pfam:Acyl-CoA_dh_1 306 455 6.7e-41 PFAM
Pfam:Acyl-CoA_dh_2 321 445 2.8e-12 PFAM
Blast:HisKA 460 557 6e-10 BLAST
low complexity region 558 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019362
AA Change: T250S

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000019362
Gene: ENSMUSG00000020888
AA Change: T250S

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
Pfam:Dishevelled 103 263 1.5e-60 PFAM
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102574
SMART Domains Protein: ENSMUSP00000099634
Gene: ENSMUSG00000018574

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 96 210 2.5e-25 PFAM
Pfam:Acyl-CoA_dh_M 214 316 5.5e-25 PFAM
Pfam:Acyl-CoA_dh_1 328 477 2.5e-41 PFAM
Pfam:Acyl-CoA_dh_2 343 467 8.7e-14 PFAM
Blast:HisKA 482 579 7e-10 BLAST
low complexity region 580 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102575
AA Change: T250S

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099635
Gene: ENSMUSG00000020888
AA Change: T250S

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152732
Predicted Effect probably benign
Transcript: ENSMUST00000190940
AA Change: T250S

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140073
Gene: ENSMUSG00000020888
AA Change: T250S

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dishevelled (dsh) protein family. The vertebrate dsh proteins have approximately 40% amino acid sequence similarity with Drosophila dsh. This gene encodes a 90-kD protein that undergoes posttranslational phosphorylation to form a 95-kD cytoplasmic protein, which may play a role in the signal transduction pathway mediated by multiple Wnt proteins. The mechanisms of dishevelled function in Wnt signaling are likely to be conserved among metazoans. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice show incomplete penetrance of perinatal lethality with surviving mice being predominantly female. Defects include cardiovascular outflow and neural tube abnormalities, malformations of vertebrae and ribs, and irregular somite segmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,528,981 M4276I probably benign Het
Apol7b A T 15: 77,423,403 F297L possibly damaging Het
C330027C09Rik T A 16: 49,000,293 N132K probably damaging Het
Capsl C T 15: 9,457,721 R9W probably damaging Het
Catsperb T C 12: 101,625,732 V1107A probably benign Het
Clca1 T C 3: 145,009,743 I544M probably benign Het
Cma2 T C 14: 55,972,823 V55A probably benign Het
Col10a1 A T 10: 34,394,838 I269F probably benign Het
Col26a1 G A 5: 136,744,166 H385Y probably damaging Het
Ctdp1 A G 18: 80,449,487 Y598H probably damaging Het
Dnajc1 A G 2: 18,284,709 S296P probably benign Het
Etv1 A G 12: 38,865,564 Y410C probably damaging Het
Gm38394 G A 1: 133,659,203 T132I probably damaging Het
Krcc1 A T 6: 71,284,628 K215* probably null Het
Lrr1 A T 12: 69,175,022 T313S probably benign Het
Lrrc7 T A 3: 158,160,402 E1234V probably damaging Het
Mepe G A 5: 104,338,248 R418H probably damaging Het
Myrfl G A 10: 116,831,542 T331I probably damaging Het
Nbeal1 T C 1: 60,194,528 W26R probably damaging Het
Nsrp1 G A 11: 77,046,027 P448S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfml2a A G 2: 38,959,813 N514D probably damaging Het
Olfr1390 T G 11: 49,340,590 D19E probably damaging Het
Olfr167 T C 16: 19,515,046 T197A probably benign Het
Pcdhb1 C T 18: 37,265,544 R183C probably damaging Het
Phf14 T G 6: 11,941,496 C41G probably damaging Het
Pkhd1l1 T C 15: 44,498,051 V499A possibly damaging Het
Plcb4 A G 2: 135,968,394 I638V probably benign Het
Ppp4c T A 7: 126,786,200 I296F probably benign Het
Prkdc T C 16: 15,759,746 V2388A probably damaging Het
Rgl1 T C 1: 152,544,433 D353G probably benign Het
Rnf19b T G 4: 129,075,567 probably null Het
Ryr3 C T 2: 112,958,176 D190N probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e G A 5: 14,232,084 M411I probably damaging Het
Sgsh A T 11: 119,346,578 Y403* probably null Het
Sh2d7 T A 9: 54,541,187 L164Q probably benign Het
Slfn8 A T 11: 83,003,488 V775E probably damaging Het
Smgc G A 15: 91,860,600 G287S probably damaging Het
Soat1 T A 1: 156,434,175 Y421F probably damaging Het
Sri T C 5: 8,059,416 Y52H probably damaging Het
Stat4 C A 1: 52,076,677 Q259K probably damaging Het
Trpm5 A G 7: 143,074,469 L1023P probably damaging Het
Ush1c T A 7: 46,208,914 N650I probably benign Het
Vmn2r8 G T 5: 108,803,219 S120* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp629 A G 7: 127,610,229 S803P probably benign Het
Zfp629 T C 7: 127,611,887 K250R probably damaging Het
Zfp758 T A 17: 22,375,190 I187N probably benign Het
Zfp85 T A 13: 67,749,716 K79I probably damaging Het
Other mutations in Dvl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Dvl2 APN 11 70009584 missense possibly damaging 0.86
IGL01465:Dvl2 APN 11 70006354 missense probably damaging 1.00
IGL01920:Dvl2 APN 11 70008047 missense probably benign 0.02
IGL01985:Dvl2 APN 11 70008293 missense probably damaging 1.00
IGL02071:Dvl2 APN 11 70004800 splice site probably null
IGL02110:Dvl2 APN 11 70008016 splice site probably benign
IGL03132:Dvl2 APN 11 70005688 missense probably benign 0.01
R0076:Dvl2 UTSW 11 70008100 missense probably damaging 0.99
R0076:Dvl2 UTSW 11 70008100 missense probably damaging 0.99
R0331:Dvl2 UTSW 11 70006217 splice site probably benign
R0335:Dvl2 UTSW 11 70001035 splice site probably benign
R1552:Dvl2 UTSW 11 70006372 missense possibly damaging 0.92
R1726:Dvl2 UTSW 11 70009461 missense probably benign
R3103:Dvl2 UTSW 11 70008869 missense possibly damaging 0.82
R4688:Dvl2 UTSW 11 70007518 missense possibly damaging 0.82
R4812:Dvl2 UTSW 11 70011293 utr 3 prime probably benign
R5319:Dvl2 UTSW 11 70008131 missense possibly damaging 0.91
R5521:Dvl2 UTSW 11 70006407 missense probably damaging 0.98
R5647:Dvl2 UTSW 11 70009449 missense possibly damaging 0.91
R5721:Dvl2 UTSW 11 70005993 missense possibly damaging 0.95
R6053:Dvl2 UTSW 11 70005993 missense possibly damaging 0.95
R6812:Dvl2 UTSW 11 70000995 missense probably damaging 1.00
R6818:Dvl2 UTSW 11 70009273 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCTATCAGGTTCAGCAGCTCCAC -3'
(R):5'- TGCAAAAGCATGTCTCCAGGCTC -3'

Sequencing Primer
(F):5'- ACTGAGCAGAGCAGTGCC -3'
(R):5'- TACTTTGGCCCACAATGGAG -3'
Posted On2014-01-15