Incidental Mutation 'R1187:Slfn8'
ID102283
Institutional Source Beutler Lab
Gene Symbol Slfn8
Ensembl Gene ENSMUSG00000035208
Gene Nameschlafen 8
Synonyms
MMRRC Submission 039259-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1187 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location83002158-83020810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83003488 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 775 (V775E)
Ref Sequence ENSEMBL: ENSMUSP00000090513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]
Predicted Effect probably damaging
Transcript: ENSMUST00000038141
AA Change: V775E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: V775E

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 1.6e-18 PFAM
Pfam:DUF2075 592 766 5.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092838
AA Change: V775E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: V775E

DomainStartEndE-ValueType
Pfam:AlbA_2 205 341 1.4e-17 PFAM
Pfam:DUF2075 592 767 2.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108152
SMART Domains Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 4.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130822
SMART Domains Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 3.7e-19 PFAM
SCOP:d1ly1a_ 593 625 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131883
SMART Domains Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AlbA_2 27 163 1.8e-15 PFAM
SCOP:d1ly1a_ 370 402 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215239
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,528,981 M4276I probably benign Het
Apol7b A T 15: 77,423,403 F297L possibly damaging Het
C330027C09Rik T A 16: 49,000,293 N132K probably damaging Het
Capsl C T 15: 9,457,721 R9W probably damaging Het
Catsperb T C 12: 101,625,732 V1107A probably benign Het
Clca1 T C 3: 145,009,743 I544M probably benign Het
Cma2 T C 14: 55,972,823 V55A probably benign Het
Col10a1 A T 10: 34,394,838 I269F probably benign Het
Col26a1 G A 5: 136,744,166 H385Y probably damaging Het
Ctdp1 A G 18: 80,449,487 Y598H probably damaging Het
Dnajc1 A G 2: 18,284,709 S296P probably benign Het
Dvl2 A T 11: 70,006,136 T250S probably benign Het
Etv1 A G 12: 38,865,564 Y410C probably damaging Het
Gm38394 G A 1: 133,659,203 T132I probably damaging Het
Krcc1 A T 6: 71,284,628 K215* probably null Het
Lrr1 A T 12: 69,175,022 T313S probably benign Het
Lrrc7 T A 3: 158,160,402 E1234V probably damaging Het
Mepe G A 5: 104,338,248 R418H probably damaging Het
Myrfl G A 10: 116,831,542 T331I probably damaging Het
Nbeal1 T C 1: 60,194,528 W26R probably damaging Het
Nsrp1 G A 11: 77,046,027 P448S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfml2a A G 2: 38,959,813 N514D probably damaging Het
Olfr1390 T G 11: 49,340,590 D19E probably damaging Het
Olfr167 T C 16: 19,515,046 T197A probably benign Het
Pcdhb1 C T 18: 37,265,544 R183C probably damaging Het
Phf14 T G 6: 11,941,496 C41G probably damaging Het
Pkhd1l1 T C 15: 44,498,051 V499A possibly damaging Het
Plcb4 A G 2: 135,968,394 I638V probably benign Het
Ppp4c T A 7: 126,786,200 I296F probably benign Het
Prkdc T C 16: 15,759,746 V2388A probably damaging Het
Rgl1 T C 1: 152,544,433 D353G probably benign Het
Rnf19b T G 4: 129,075,567 probably null Het
Ryr3 C T 2: 112,958,176 D190N probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e G A 5: 14,232,084 M411I probably damaging Het
Sgsh A T 11: 119,346,578 Y403* probably null Het
Sh2d7 T A 9: 54,541,187 L164Q probably benign Het
Smgc G A 15: 91,860,600 G287S probably damaging Het
Soat1 T A 1: 156,434,175 Y421F probably damaging Het
Sri T C 5: 8,059,416 Y52H probably damaging Het
Stat4 C A 1: 52,076,677 Q259K probably damaging Het
Trpm5 A G 7: 143,074,469 L1023P probably damaging Het
Ush1c T A 7: 46,208,914 N650I probably benign Het
Vmn2r8 G T 5: 108,803,219 S120* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp629 A G 7: 127,610,229 S803P probably benign Het
Zfp629 T C 7: 127,611,887 K250R probably damaging Het
Zfp758 T A 17: 22,375,190 I187N probably benign Het
Zfp85 T A 13: 67,749,716 K79I probably damaging Het
Other mutations in Slfn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Slfn8 APN 11 83013484 missense possibly damaging 0.75
IGL01418:Slfn8 APN 11 83004636 missense probably damaging 1.00
IGL01620:Slfn8 APN 11 83004233 nonsense probably null
IGL01875:Slfn8 APN 11 83004079 missense probably benign 0.30
IGL01896:Slfn8 APN 11 83003696 missense probably damaging 1.00
IGL01929:Slfn8 APN 11 83003405 nonsense probably null
IGL02111:Slfn8 APN 11 83004498 missense probably damaging 1.00
IGL02136:Slfn8 APN 11 83003465 nonsense probably null
IGL02165:Slfn8 APN 11 83017196 missense probably benign 0.00
IGL02645:Slfn8 APN 11 83003554 missense possibly damaging 0.82
IGL02682:Slfn8 APN 11 83003691 missense probably damaging 1.00
IGL02689:Slfn8 APN 11 83017108 missense probably damaging 1.00
IGL02948:Slfn8 APN 11 83003252 missense probably damaging 0.99
IGL03037:Slfn8 APN 11 83003252 missense probably damaging 0.99
IGL03185:Slfn8 APN 11 83017507 missense probably benign 0.01
IGL03243:Slfn8 APN 11 83003707 missense probably damaging 1.00
IGL03286:Slfn8 APN 11 83013468 missense probably damaging 0.99
R0295:Slfn8 UTSW 11 83003343 nonsense probably null
R0368:Slfn8 UTSW 11 83017132 missense probably damaging 1.00
R0382:Slfn8 UTSW 11 83004556 missense probably damaging 1.00
R0655:Slfn8 UTSW 11 83003821 missense probably benign 0.35
R0894:Slfn8 UTSW 11 83003581 missense probably benign 0.07
R1006:Slfn8 UTSW 11 83003511 missense possibly damaging 0.69
R1181:Slfn8 UTSW 11 83016745 missense probably benign 0.19
R1501:Slfn8 UTSW 11 83003180 missense probably damaging 0.99
R1646:Slfn8 UTSW 11 83016886 missense probably damaging 1.00
R1909:Slfn8 UTSW 11 83003621 nonsense probably null
R2005:Slfn8 UTSW 11 83004150 missense probably damaging 1.00
R2363:Slfn8 UTSW 11 83004094 missense probably damaging 1.00
R3780:Slfn8 UTSW 11 83017454 missense probably benign 0.13
R3890:Slfn8 UTSW 11 83004444 missense possibly damaging 0.68
R3917:Slfn8 UTSW 11 83016993 nonsense probably null
R4559:Slfn8 UTSW 11 83004744 missense probably damaging 1.00
R4684:Slfn8 UTSW 11 83017506 missense probably benign 0.10
R4767:Slfn8 UTSW 11 83003197 missense possibly damaging 0.66
R4773:Slfn8 UTSW 11 83017393 missense probably damaging 1.00
R4859:Slfn8 UTSW 11 83017714 start codon destroyed probably null 0.99
R4916:Slfn8 UTSW 11 83016878 missense probably damaging 1.00
R4939:Slfn8 UTSW 11 83003285 missense probably benign 0.01
R5107:Slfn8 UTSW 11 83017150 missense probably damaging 0.99
R5130:Slfn8 UTSW 11 83003821 missense probably benign 0.35
R5165:Slfn8 UTSW 11 83017127 missense probably damaging 0.99
R5238:Slfn8 UTSW 11 83013388 missense probably damaging 0.96
R5282:Slfn8 UTSW 11 83017724 critical splice acceptor site probably null
R5311:Slfn8 UTSW 11 83004084 missense probably damaging 1.00
R5499:Slfn8 UTSW 11 83004216 missense probably damaging 0.99
R5617:Slfn8 UTSW 11 83004721 missense probably benign 0.01
R5782:Slfn8 UTSW 11 83017041 missense probably damaging 0.98
R5823:Slfn8 UTSW 11 83016736 missense probably benign 0.01
R5886:Slfn8 UTSW 11 83003334 missense probably benign 0.09
R5933:Slfn8 UTSW 11 83003335 missense probably benign 0.00
R6151:Slfn8 UTSW 11 83017321 missense probably damaging 1.00
R6163:Slfn8 UTSW 11 83003864 makesense probably null
R6191:Slfn8 UTSW 11 83016800 missense possibly damaging 0.72
R6419:Slfn8 UTSW 11 83004055 unclassified probably null
R6925:Slfn8 UTSW 11 83013417 nonsense probably null
R7065:Slfn8 UTSW 11 83016968 missense probably benign 0.01
R7380:Slfn8 UTSW 11 83003740 missense not run
R7414:Slfn8 UTSW 11 83016792 nonsense probably null
R7819:Slfn8 UTSW 11 83004255 missense probably damaging 1.00
X0021:Slfn8 UTSW 11 83016928 missense possibly damaging 0.69
Z1177:Slfn8 UTSW 11 83003533 missense not run
Predicted Primers PCR Primer
(F):5'- CTTTCCAGTCCTGAGAATCGACGG -3'
(R):5'- TCACGCCAGTATCCAAGGGAAGAG -3'

Sequencing Primer
(F):5'- TCGACGGATGCTGTCAAAC -3'
(R):5'- GCTCACACAAGTAGTACGCAATG -3'
Posted On2014-01-15