Incidental Mutation 'R1187:Sgsh'
ID102285
Institutional Source Beutler Lab
Gene Symbol Sgsh
Ensembl Gene ENSMUSG00000005043
Gene NameN-sulfoglucosamine sulfohydrolase (sulfamidase)
Synonymssulphamidase, 4632406A19Rik
MMRRC Submission 039259-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R1187 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119343425-119355536 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 119346578 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 403 (Y403*)
Ref Sequence ENSEMBL: ENSMUSP00000005173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005173] [ENSMUST00000053245] [ENSMUST00000100172] [ENSMUST00000106250] [ENSMUST00000136523]
Predicted Effect probably null
Transcript: ENSMUST00000005173
AA Change: Y403*
SMART Domains Protein: ENSMUSP00000005173
Gene: ENSMUSG00000005043
AA Change: Y403*

DomainStartEndE-ValueType
Pfam:Sulfatase 23 328 2.6e-60 PFAM
Pfam:Phosphodiest 25 287 5.2e-8 PFAM
low complexity region 348 357 N/A INTRINSIC
Pfam:DUF4976 400 477 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053245
SMART Domains Protein: ENSMUSP00000053665
Gene: ENSMUSG00000013483

DomainStartEndE-ValueType
Pfam:CARD 20 106 4.1e-25 PFAM
coiled coil region 126 173 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
coiled coil region 280 377 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 473 483 N/A INTRINSIC
low complexity region 541 551 N/A INTRINSIC
PDZ 578 657 5.51e-3 SMART
Blast:SH3 676 735 4e-25 BLAST
low complexity region 736 746 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Blast:GuKc 826 989 4e-63 BLAST
SCOP:d1kjwa2 855 994 2e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000100172
AA Change: C373S
SMART Domains Protein: ENSMUSP00000097748
Gene: ENSMUSG00000005043
AA Change: C373S

DomainStartEndE-ValueType
Pfam:Sulfatase 23 250 1.7e-35 PFAM
Pfam:Phosphodiest 25 237 2.7e-8 PFAM
low complexity region 311 329 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106250
SMART Domains Protein: ENSMUSP00000101857
Gene: ENSMUSG00000013483

DomainStartEndE-ValueType
Pfam:CARD 20 106 2.8e-25 PFAM
coiled coil region 126 173 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
coiled coil region 280 377 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 473 483 N/A INTRINSIC
low complexity region 541 551 N/A INTRINSIC
PDZ 578 657 5.51e-3 SMART
Blast:SH3 676 735 4e-25 BLAST
low complexity region 736 746 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Blast:GuKc 826 989 4e-63 BLAST
SCOP:d1kjwa2 855 994 2e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133507
Predicted Effect probably benign
Transcript: ENSMUST00000136523
SMART Domains Protein: ENSMUSP00000115587
Gene: ENSMUSG00000005043

DomainStartEndE-ValueType
PDB:4MIV|H 1 30 1e-5 PDB
low complexity region 40 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151052
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with Sanfilippo syndrome A, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele die prematurely displaying low sulfamidase activity, variable lysosomal storage in various brain cell types and other tissues, heparan sulfate-uria, scruffy coats, corneal opacities, bladder distension, hydronephrosis, hepatosplenomegaly and bone deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,528,981 M4276I probably benign Het
Apol7b A T 15: 77,423,403 F297L possibly damaging Het
C330027C09Rik T A 16: 49,000,293 N132K probably damaging Het
Capsl C T 15: 9,457,721 R9W probably damaging Het
Catsperb T C 12: 101,625,732 V1107A probably benign Het
Clca1 T C 3: 145,009,743 I544M probably benign Het
Cma2 T C 14: 55,972,823 V55A probably benign Het
Col10a1 A T 10: 34,394,838 I269F probably benign Het
Col26a1 G A 5: 136,744,166 H385Y probably damaging Het
Ctdp1 A G 18: 80,449,487 Y598H probably damaging Het
Dnajc1 A G 2: 18,284,709 S296P probably benign Het
Dvl2 A T 11: 70,006,136 T250S probably benign Het
Etv1 A G 12: 38,865,564 Y410C probably damaging Het
Gm38394 G A 1: 133,659,203 T132I probably damaging Het
Krcc1 A T 6: 71,284,628 K215* probably null Het
Lrr1 A T 12: 69,175,022 T313S probably benign Het
Lrrc7 T A 3: 158,160,402 E1234V probably damaging Het
Mepe G A 5: 104,338,248 R418H probably damaging Het
Myrfl G A 10: 116,831,542 T331I probably damaging Het
Nbeal1 T C 1: 60,194,528 W26R probably damaging Het
Nsrp1 G A 11: 77,046,027 P448S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfml2a A G 2: 38,959,813 N514D probably damaging Het
Olfr1390 T G 11: 49,340,590 D19E probably damaging Het
Olfr167 T C 16: 19,515,046 T197A probably benign Het
Pcdhb1 C T 18: 37,265,544 R183C probably damaging Het
Phf14 T G 6: 11,941,496 C41G probably damaging Het
Pkhd1l1 T C 15: 44,498,051 V499A possibly damaging Het
Plcb4 A G 2: 135,968,394 I638V probably benign Het
Ppp4c T A 7: 126,786,200 I296F probably benign Het
Prkdc T C 16: 15,759,746 V2388A probably damaging Het
Rgl1 T C 1: 152,544,433 D353G probably benign Het
Rnf19b T G 4: 129,075,567 probably null Het
Ryr3 C T 2: 112,958,176 D190N probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e G A 5: 14,232,084 M411I probably damaging Het
Sh2d7 T A 9: 54,541,187 L164Q probably benign Het
Slfn8 A T 11: 83,003,488 V775E probably damaging Het
Smgc G A 15: 91,860,600 G287S probably damaging Het
Soat1 T A 1: 156,434,175 Y421F probably damaging Het
Sri T C 5: 8,059,416 Y52H probably damaging Het
Stat4 C A 1: 52,076,677 Q259K probably damaging Het
Trpm5 A G 7: 143,074,469 L1023P probably damaging Het
Ush1c T A 7: 46,208,914 N650I probably benign Het
Vmn2r8 G T 5: 108,803,219 S120* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp629 A G 7: 127,610,229 S803P probably benign Het
Zfp629 T C 7: 127,611,887 K250R probably damaging Het
Zfp758 T A 17: 22,375,190 I187N probably benign Het
Zfp85 T A 13: 67,749,716 K79I probably damaging Het
Other mutations in Sgsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Sgsh APN 11 119346485 missense probably benign
IGL01549:Sgsh APN 11 119350929 missense probably damaging 0.99
IGL02110:Sgsh APN 11 119352806 missense probably damaging 1.00
IGL02878:Sgsh APN 11 119346558 missense probably damaging 1.00
R2342:Sgsh UTSW 11 119347714 missense probably benign 0.01
R2472:Sgsh UTSW 11 119355474 missense possibly damaging 0.83
R2571:Sgsh UTSW 11 119350514 missense probably damaging 1.00
R3872:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R3873:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R3874:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R3875:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R5075:Sgsh UTSW 11 119346768 missense probably benign 0.34
R5660:Sgsh UTSW 11 119350981 missense probably damaging 1.00
R5938:Sgsh UTSW 11 119346799 missense probably benign 0.08
R7302:Sgsh UTSW 11 119347699 missense probably benign 0.02
R7484:Sgsh UTSW 11 119346357 missense probably damaging 1.00
R7533:Sgsh UTSW 11 119347870 missense probably damaging 1.00
R7552:Sgsh UTSW 11 119346552 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTTTCAGCATCTCCAGCAC -3'
(R):5'- CCACTAAGAGCCTGTTCCTTTCCAG -3'

Sequencing Primer
(F):5'- AGCACTTGAGCCAAGTCTG -3'
(R):5'- CTTTGGCTCAAAGACGATCC -3'
Posted On2014-01-15