Incidental Mutation 'R1187:Olfr167'
ID102312
Institutional Source Beutler Lab
Gene Symbol Olfr167
Ensembl Gene ENSMUSG00000045341
Gene Nameolfactory receptor 167
SynonymsMOR272-1, GA_x54KRFPKG5P-15963726-15962788
MMRRC Submission 039259-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R1187 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location19509558-19522266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19515046 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 197 (T197A)
Ref Sequence ENSEMBL: ENSMUSP00000150102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054606] [ENSMUST00000214315]
Predicted Effect probably benign
Transcript: ENSMUST00000054606
AA Change: T197A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000055344
Gene: ENSMUSG00000045341
AA Change: T197A

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-46 PFAM
Pfam:7TM_GPCR_Srsx 33 295 1.2e-6 PFAM
Pfam:7tm_1 40 289 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214315
AA Change: T197A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217566
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,528,981 M4276I probably benign Het
Apol7b A T 15: 77,423,403 F297L possibly damaging Het
C330027C09Rik T A 16: 49,000,293 N132K probably damaging Het
Capsl C T 15: 9,457,721 R9W probably damaging Het
Catsperb T C 12: 101,625,732 V1107A probably benign Het
Clca1 T C 3: 145,009,743 I544M probably benign Het
Cma2 T C 14: 55,972,823 V55A probably benign Het
Col10a1 A T 10: 34,394,838 I269F probably benign Het
Col26a1 G A 5: 136,744,166 H385Y probably damaging Het
Ctdp1 A G 18: 80,449,487 Y598H probably damaging Het
Dnajc1 A G 2: 18,284,709 S296P probably benign Het
Dvl2 A T 11: 70,006,136 T250S probably benign Het
Etv1 A G 12: 38,865,564 Y410C probably damaging Het
Gm38394 G A 1: 133,659,203 T132I probably damaging Het
Krcc1 A T 6: 71,284,628 K215* probably null Het
Lrr1 A T 12: 69,175,022 T313S probably benign Het
Lrrc7 T A 3: 158,160,402 E1234V probably damaging Het
Mepe G A 5: 104,338,248 R418H probably damaging Het
Myrfl G A 10: 116,831,542 T331I probably damaging Het
Nbeal1 T C 1: 60,194,528 W26R probably damaging Het
Nsrp1 G A 11: 77,046,027 P448S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfml2a A G 2: 38,959,813 N514D probably damaging Het
Olfr1390 T G 11: 49,340,590 D19E probably damaging Het
Pcdhb1 C T 18: 37,265,544 R183C probably damaging Het
Phf14 T G 6: 11,941,496 C41G probably damaging Het
Pkhd1l1 T C 15: 44,498,051 V499A possibly damaging Het
Plcb4 A G 2: 135,968,394 I638V probably benign Het
Ppp4c T A 7: 126,786,200 I296F probably benign Het
Prkdc T C 16: 15,759,746 V2388A probably damaging Het
Rgl1 T C 1: 152,544,433 D353G probably benign Het
Rnf19b T G 4: 129,075,567 probably null Het
Ryr3 C T 2: 112,958,176 D190N probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e G A 5: 14,232,084 M411I probably damaging Het
Sgsh A T 11: 119,346,578 Y403* probably null Het
Sh2d7 T A 9: 54,541,187 L164Q probably benign Het
Slfn8 A T 11: 83,003,488 V775E probably damaging Het
Smgc G A 15: 91,860,600 G287S probably damaging Het
Soat1 T A 1: 156,434,175 Y421F probably damaging Het
Sri T C 5: 8,059,416 Y52H probably damaging Het
Stat4 C A 1: 52,076,677 Q259K probably damaging Het
Trpm5 A G 7: 143,074,469 L1023P probably damaging Het
Ush1c T A 7: 46,208,914 N650I probably benign Het
Vmn2r8 G T 5: 108,803,219 S120* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp629 A G 7: 127,610,229 S803P probably benign Het
Zfp629 T C 7: 127,611,887 K250R probably damaging Het
Zfp758 T A 17: 22,375,190 I187N probably benign Het
Zfp85 T A 13: 67,749,716 K79I probably damaging Het
Other mutations in Olfr167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Olfr167 APN 16 19515478 missense probably benign 0.01
IGL02115:Olfr167 APN 16 19515103 missense probably damaging 1.00
IGL02562:Olfr167 APN 16 19514964 missense possibly damaging 0.74
R0366:Olfr167 UTSW 16 19514848 missense probably benign 0.13
R0673:Olfr167 UTSW 16 19515396 missense probably damaging 1.00
R1237:Olfr167 UTSW 16 19515625 missense probably benign 0.01
R1975:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1977:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1997:Olfr167 UTSW 16 19515042 missense probably damaging 1.00
R2225:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R2226:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R4078:Olfr167 UTSW 16 19515232 missense possibly damaging 0.76
R5019:Olfr167 UTSW 16 19515535 missense probably damaging 0.99
R5071:Olfr167 UTSW 16 19515027 missense probably benign 0.00
R5278:Olfr167 UTSW 16 19515378 nonsense probably null
R5415:Olfr167 UTSW 16 19515246 missense possibly damaging 0.94
R5744:Olfr167 UTSW 16 19515336 missense probably benign 0.00
R5991:Olfr167 UTSW 16 19514757 missense probably damaging 0.99
R6151:Olfr167 UTSW 16 19515531 missense probably damaging 1.00
R6540:Olfr167 UTSW 16 19514821 missense probably benign
R7014:Olfr167 UTSW 16 19515456 missense probably benign 0.20
R7145:Olfr167 UTSW 16 19514899 missense probably damaging 0.99
R7535:Olfr167 UTSW 16 19514794 missense probably damaging 1.00
R7677:Olfr167 UTSW 16 19514928 missense probably benign 0.42
R7715:Olfr167 UTSW 16 19514730 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGTGAGTCATCCTTCTCAGGGC -3'
(R):5'- GTGCAGAAACCCTTTTGTTGGCATC -3'

Sequencing Primer
(F):5'- GAAGACTGCAAGAATCTTGTCCTC -3'
(R):5'- GGCATCTATGGCCTATGACC -3'
Posted On2014-01-15