Incidental Mutation 'R1187:Zbtb14'
ID102318
Institutional Source Beutler Lab
Gene Symbol Zbtb14
Ensembl Gene ENSMUSG00000049672
Gene Namezinc finger and BTB domain containing 14
SynonymsZfp161, b2b1982Clo, ZF5
MMRRC Submission 039259-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.802) question?
Stock #R1187 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location69383050-69390750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69388502 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 398 (F398L)
Ref Sequence ENSEMBL: ENSMUSP00000108296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062369] [ENSMUST00000112674] [ENSMUST00000112676]
Predicted Effect probably damaging
Transcript: ENSMUST00000062369
AA Change: F398L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054897
Gene: ENSMUSG00000049672
AA Change: F398L

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112674
AA Change: F398L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108294
Gene: ENSMUSG00000049672
AA Change: F398L

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112676
AA Change: F398L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108296
Gene: ENSMUSG00000049672
AA Change: F398L

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation show exencephaly, cardiac defects including valve abnormalities, double outlet right ventricle, perimembranous ventricular septal defect, and atrioventricular septal defect, and renal anomalies such as duplex kidney, hydronephrosis, and kidney cysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,528,981 M4276I probably benign Het
Apol7b A T 15: 77,423,403 F297L possibly damaging Het
C330027C09Rik T A 16: 49,000,293 N132K probably damaging Het
Capsl C T 15: 9,457,721 R9W probably damaging Het
Catsperb T C 12: 101,625,732 V1107A probably benign Het
Clca1 T C 3: 145,009,743 I544M probably benign Het
Cma2 T C 14: 55,972,823 V55A probably benign Het
Col10a1 A T 10: 34,394,838 I269F probably benign Het
Col26a1 G A 5: 136,744,166 H385Y probably damaging Het
Ctdp1 A G 18: 80,449,487 Y598H probably damaging Het
Dnajc1 A G 2: 18,284,709 S296P probably benign Het
Dvl2 A T 11: 70,006,136 T250S probably benign Het
Etv1 A G 12: 38,865,564 Y410C probably damaging Het
Gm38394 G A 1: 133,659,203 T132I probably damaging Het
Krcc1 A T 6: 71,284,628 K215* probably null Het
Lrr1 A T 12: 69,175,022 T313S probably benign Het
Lrrc7 T A 3: 158,160,402 E1234V probably damaging Het
Mepe G A 5: 104,338,248 R418H probably damaging Het
Myrfl G A 10: 116,831,542 T331I probably damaging Het
Nbeal1 T C 1: 60,194,528 W26R probably damaging Het
Nsrp1 G A 11: 77,046,027 P448S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfml2a A G 2: 38,959,813 N514D probably damaging Het
Olfr1390 T G 11: 49,340,590 D19E probably damaging Het
Olfr167 T C 16: 19,515,046 T197A probably benign Het
Pcdhb1 C T 18: 37,265,544 R183C probably damaging Het
Phf14 T G 6: 11,941,496 C41G probably damaging Het
Pkhd1l1 T C 15: 44,498,051 V499A possibly damaging Het
Plcb4 A G 2: 135,968,394 I638V probably benign Het
Ppp4c T A 7: 126,786,200 I296F probably benign Het
Prkdc T C 16: 15,759,746 V2388A probably damaging Het
Rgl1 T C 1: 152,544,433 D353G probably benign Het
Rnf19b T G 4: 129,075,567 probably null Het
Ryr3 C T 2: 112,958,176 D190N probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e G A 5: 14,232,084 M411I probably damaging Het
Sgsh A T 11: 119,346,578 Y403* probably null Het
Sh2d7 T A 9: 54,541,187 L164Q probably benign Het
Slfn8 A T 11: 83,003,488 V775E probably damaging Het
Smgc G A 15: 91,860,600 G287S probably damaging Het
Soat1 T A 1: 156,434,175 Y421F probably damaging Het
Sri T C 5: 8,059,416 Y52H probably damaging Het
Stat4 C A 1: 52,076,677 Q259K probably damaging Het
Trpm5 A G 7: 143,074,469 L1023P probably damaging Het
Ush1c T A 7: 46,208,914 N650I probably benign Het
Vmn2r8 G T 5: 108,803,219 S120* probably null Het
Zfp629 A G 7: 127,610,229 S803P probably benign Het
Zfp629 T C 7: 127,611,887 K250R probably damaging Het
Zfp758 T A 17: 22,375,190 I187N probably benign Het
Zfp85 T A 13: 67,749,716 K79I probably damaging Het
Other mutations in Zbtb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Zbtb14 APN 17 69388189 missense probably benign 0.04
IGL01623:Zbtb14 APN 17 69388189 missense probably benign 0.04
IGL02477:Zbtb14 APN 17 69387695 missense probably benign 0.00
PIT4687001:Zbtb14 UTSW 17 69388307 nonsense probably null
R0736:Zbtb14 UTSW 17 69387802 missense possibly damaging 0.66
R0811:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0812:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0829:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0866:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0946:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0947:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1052:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1053:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1056:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1076:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1374:Zbtb14 UTSW 17 69387580 missense probably damaging 1.00
R1471:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1505:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1507:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1508:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1509:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1514:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1680:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1691:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1712:Zbtb14 UTSW 17 69387580 missense probably damaging 1.00
R1907:Zbtb14 UTSW 17 69387390 missense possibly damaging 0.91
R1981:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R2916:Zbtb14 UTSW 17 69388219 missense probably damaging 1.00
R2918:Zbtb14 UTSW 17 69388219 missense probably damaging 1.00
R4589:Zbtb14 UTSW 17 69388470 missense probably damaging 1.00
R4622:Zbtb14 UTSW 17 69388347 missense possibly damaging 0.80
R4812:Zbtb14 UTSW 17 69387582 missense probably damaging 1.00
R6246:Zbtb14 UTSW 17 69387483 missense possibly damaging 0.46
R6889:Zbtb14 UTSW 17 69387679 missense probably damaging 1.00
R7575:Zbtb14 UTSW 17 69387447 missense probably damaging 0.98
R7716:Zbtb14 UTSW 17 69387420 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCGAGGTGTGCGGAAAGTCATTC -3'
(R):5'- GCCACAAAGCGGTCAAAGGTGTTC -3'

Sequencing Primer
(F):5'- CGGAAAGTCATTCATCCGC -3'
(R):5'- AGGTGTTCACTGACTACAGC -3'
Posted On2014-01-15