Incidental Mutation 'R1188:Mrps26'
ID102336
Institutional Source Beutler Lab
Gene Symbol Mrps26
Ensembl Gene ENSMUSG00000037740
Gene Namemitochondrial ribosomal protein S26
SynonymsRpms13, GI008, MRP-S13, MRP-S26
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.847) question?
Stock #R1188 (G1)
Quality Score109
Status Not validated
Chromosome2
Chromosomal Location130563742-130568695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130564381 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 145 (E145K)
Ref Sequence ENSEMBL: ENSMUSP00000123324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145614]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000079964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136793
Predicted Effect probably damaging
Transcript: ENSMUST00000145614
AA Change: E145K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123324
Gene: ENSMUSG00000037740
AA Change: E145K

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
Pfam:MRP-S26 28 197 8.1e-59 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. This gene lies adjacent to and downstream of the gonadotropin-releasing hormone precursor gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Mrps26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03267:Mrps26 APN 2 130564936 critical splice acceptor site probably null
R0608:Mrps26 UTSW 2 130563858 missense possibly damaging 0.93
R2054:Mrps26 UTSW 2 130564167 missense probably benign 0.05
R2850:Mrps26 UTSW 2 130565047 missense probably benign 0.03
R4519:Mrps26 UTSW 2 130564349 missense probably benign
R4851:Mrps26 UTSW 2 130563761 utr 5 prime probably benign
R4930:Mrps26 UTSW 2 130564942 missense probably damaging 1.00
R5091:Mrps26 UTSW 2 130563966 missense probably damaging 1.00
R5302:Mrps26 UTSW 2 130564167 missense probably benign 0.05
R8277:Mrps26 UTSW 2 130564427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCACGTTGGAGGTGCGAAG -3'
(R):5'- ATACCCTCTGCGCTGATGGAGAAG -3'

Sequencing Primer
(F):5'- AAATTGCACGAGGCCCG -3'
(R):5'- CCAATGTCCACATTCCCCATGA -3'
Posted On2014-01-15