Incidental Mutation 'R1188:Slc17a7'
ID102355
Institutional Source Beutler Lab
Gene Symbol Slc17a7
Ensembl Gene ENSMUSG00000070570
Gene Namesolute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
Synonyms2900052E22Rik, Vglut1
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R1188 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45163949-45176142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45169887 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 129 (V129A)
Ref Sequence ENSEMBL: ENSMUSP00000082489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085374] [ENSMUST00000209634]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085374
AA Change: V129A

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082489
Gene: ENSMUSG00000070570
AA Change: V129A

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:MFS_1 68 453 9.3e-49 PFAM
transmembrane domain 468 490 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
low complexity region 550 556 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197423
Predicted Effect probably benign
Transcript: ENSMUST00000209634
AA Change: V154A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211652
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a vesicle-bound, sodium-dependent phosphate transporter that is specifically expressed in the neuron-rich regions of the brain. It is preferentially associated with the membranes of synaptic vesicles and functions in glutamate transport. The protein shares 82% identity with the differentiation-associated Na-dependent inorganic phosphate cotransporter and they appear to form a distinct class within the Na+/Pi cotransporter family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are small and fail to thrive by 3-4 weeks of age. Abnormal excitatory post synaptic potential and currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Slc17a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02208:Slc17a7 APN 7 45170943 missense probably damaging 1.00
IGL02536:Slc17a7 APN 7 45170946 missense probably damaging 1.00
IGL03057:Slc17a7 APN 7 45170939 missense probably damaging 0.98
R0081:Slc17a7 UTSW 7 45174947 missense probably benign 0.00
R1713:Slc17a7 UTSW 7 45170304 missense probably benign 0.05
R2512:Slc17a7 UTSW 7 45168864 missense probably damaging 1.00
R3915:Slc17a7 UTSW 7 45168720 missense probably damaging 0.97
R3972:Slc17a7 UTSW 7 45169910 missense possibly damaging 0.46
R4727:Slc17a7 UTSW 7 45172934 missense possibly damaging 0.64
R4761:Slc17a7 UTSW 7 45170984 missense probably benign
R6047:Slc17a7 UTSW 7 45173406 missense probably benign 0.07
R6113:Slc17a7 UTSW 7 45174751 missense possibly damaging 0.67
R6407:Slc17a7 UTSW 7 45169926 missense probably benign 0.44
R6792:Slc17a7 UTSW 7 45174875 missense possibly damaging 0.50
R7404:Slc17a7 UTSW 7 45172930 missense probably benign 0.32
R8001:Slc17a7 UTSW 7 45168788 missense probably benign 0.02
R8152:Slc17a7 UTSW 7 45170290 missense probably damaging 1.00
R8177:Slc17a7 UTSW 7 45174932 missense probably benign 0.08
X0067:Slc17a7 UTSW 7 45170272 missense possibly damaging 0.94
Z1177:Slc17a7 UTSW 7 45172927 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAGCGCCTGTAGCTAAAGTG -3'
(R):5'- GGCAAAGCCAAAGACCCTGTTGAG -3'

Sequencing Primer
(F):5'- CCTGTAGCTAAAGTGGTAGGGC -3'
(R):5'- CTAGCCATGCCAGTTATAGTGAG -3'
Posted On2014-01-15