Incidental Mutation 'R1188:Asna1'
ID102357
Institutional Source Beutler Lab
Gene Symbol Asna1
Ensembl Gene ENSMUSG00000052456
Gene NamearsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
SynonymsArsA, 1810048H22Rik
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1188 (G1)
Quality Score156
Status Not validated
Chromosome8
Chromosomal Location85017931-85025281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85019793 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 142 (I142T)
Ref Sequence ENSEMBL: ENSMUSP00000065337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064314]
Predicted Effect probably damaging
Transcript: ENSMUST00000064314
AA Change: I142T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065337
Gene: ENSMUSG00000052456
AA Change: I142T

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:ArsA_ATPase 37 340 2.2e-127 PFAM
Pfam:CbiA 39 311 5.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211702
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents the human homolog of the bacterial arsA gene, encoding the arsenite-stimulated ATPase component of the arsenite transporter responsible for resistance to arsenicals. This protein is also a central component of a transmembrane domain (TMD) recognition complex (TRC) that is involved in the post-translational delivery of tail-anchored (TA) proteins from the cytosol to the endoplasmic reticulum (ER). It recognizes and selectively binds the TMD of TA proteins in the cytosol, and delivers them to the ER for insertion. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Asna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Asna1 APN 8 85018556 missense possibly damaging 0.64
R0012:Asna1 UTSW 8 85025096 splice site probably benign
R0378:Asna1 UTSW 8 85025264 start codon destroyed probably null
R0504:Asna1 UTSW 8 85018607 missense probably damaging 1.00
R2001:Asna1 UTSW 8 85025160 missense probably damaging 0.96
R2029:Asna1 UTSW 8 85019774 nonsense probably null
R2264:Asna1 UTSW 8 85025258 unclassified probably benign
R2511:Asna1 UTSW 8 85019766 missense possibly damaging 0.79
R4676:Asna1 UTSW 8 85018873 missense probably benign 0.01
R5401:Asna1 UTSW 8 85018544 missense possibly damaging 0.56
R6465:Asna1 UTSW 8 85018565 missense probably benign 0.01
R7378:Asna1 UTSW 8 85019863 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GCTGTGTCGAACACTACCACTGAG -3'
(R):5'- TCAGAGGTGACCCACATTAGAGGC -3'

Sequencing Primer
(F):5'- GAGAAGTTCATGCCTTTCACCAG -3'
(R):5'- TGACCCACATTAGAGGCATAATCTG -3'
Posted On2014-01-15