Incidental Mutation 'R1188:Snai3'
ID102359
Institutional Source Beutler Lab
Gene Symbol Snai3
Ensembl Gene ENSMUSG00000006587
Gene Namesnail family zinc finger 3
SynonymsSnail-related gene from muscle cells, Zfp293, Smuc
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1188 (G1)
Quality Score171
Status Not validated
Chromosome8
Chromosomal Location122454208-122460733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122454962 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 252 (Q252L)
Ref Sequence ENSEMBL: ENSMUSP00000006762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006762] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000006762
AA Change: Q252L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006762
Gene: ENSMUSG00000006587
AA Change: Q252L

DomainStartEndE-ValueType
ZnF_C2H2 147 169 1.07e0 SMART
ZnF_C2H2 178 200 4.87e-4 SMART
ZnF_C2H2 204 226 1.1e-2 SMART
ZnF_C2H2 232 254 2.12e-4 SMART
ZnF_C2H2 260 280 3.56e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212387
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SNAI3 is a member of the SNAIL gene family, named for the Drosophila snail gene, which plays roles in mesodermal formation during embryogenesis (Katoh and Katoh, 2003 [PubMed 12579345]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Snai3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Snai3 APN 8 122456122 critical splice donor site probably null
PIT4418001:Snai3 UTSW 8 122456334 missense probably benign 0.00
R0648:Snai3 UTSW 8 122454994 missense probably damaging 1.00
R4990:Snai3 UTSW 8 122456332 missense possibly damaging 0.52
R4992:Snai3 UTSW 8 122456332 missense possibly damaging 0.52
R5729:Snai3 UTSW 8 122454890 missense probably benign 0.01
R6830:Snai3 UTSW 8 122456473 missense probably damaging 1.00
X0013:Snai3 UTSW 8 122454947 missense probably damaging 0.97
Z1177:Snai3 UTSW 8 122456233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGATGACAGAACCACTGAGAG -3'
(R):5'- GATTGGTAGAGACATGGCAGCCAC -3'

Sequencing Primer
(F):5'- CAGAACCACTGAGAGGATTGTC -3'
(R):5'- GCCTCAGAAGATCCTCTGATG -3'
Posted On2014-01-15