Incidental Mutation 'R1188:Olfr961'
ID102363
Institutional Source Beutler Lab
Gene Symbol Olfr961
Ensembl Gene ENSMUSG00000059106
Gene Nameolfactory receptor 961
SynonymsMOR224-5, GA_x6K02T2PVTD-33343617-33344561
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R1188 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39645085-39649556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39647476 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 250 (Y250C)
Ref Sequence ENSEMBL: ENSMUSP00000151840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076548] [ENSMUST00000219295]
Predicted Effect probably damaging
Transcript: ENSMUST00000076548
AA Change: Y250C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075863
Gene: ENSMUSG00000059106
AA Change: Y250C

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.1e-50 PFAM
Pfam:7tm_1 39 286 4.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219295
AA Change: Y250C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Olfr961
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Olfr961 APN 9 39647340 missense probably benign 0.19
IGL01792:Olfr961 APN 9 39647659 missense probably benign 0.07
R0344:Olfr961 UTSW 9 39647350 missense probably damaging 1.00
R0503:Olfr961 UTSW 9 39647476 missense probably damaging 1.00
R0525:Olfr961 UTSW 9 39647471 missense probably damaging 1.00
R0531:Olfr961 UTSW 9 39646872 missense probably benign
R1453:Olfr961 UTSW 9 39647163 missense probably benign 0.01
R2970:Olfr961 UTSW 9 39646899 missense probably damaging 1.00
R3883:Olfr961 UTSW 9 39647124 missense probably benign 0.07
R4423:Olfr961 UTSW 9 39647116 missense probably damaging 1.00
R5129:Olfr961 UTSW 9 39647494 missense probably benign 0.03
R6148:Olfr961 UTSW 9 39647259 missense probably damaging 1.00
R6738:Olfr961 UTSW 9 39646661 start gained probably benign
R6778:Olfr961 UTSW 9 39646747 missense probably damaging 1.00
R7194:Olfr961 UTSW 9 39647091 missense probably benign 0.15
R7545:Olfr961 UTSW 9 39647107 missense probably damaging 0.97
RF008:Olfr961 UTSW 9 39647263 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGCCTATGACCGCTTTGTTGC -3'
(R):5'- TACATGCCTCAGGGCTGCTTTCAC -3'

Sequencing Primer
(F):5'- ATTCCTCTCTAGCACAGAGGGTAG -3'
(R):5'- AGGGCTGCTTTCACATCCTTG -3'
Posted On2014-01-15