Incidental Mutation 'R1188:Avpr1a'
ID102373
Institutional Source Beutler Lab
Gene Symbol Avpr1a
Ensembl Gene ENSMUSG00000020123
Gene Namearginine vasopressin receptor 1A
SynonymsV1aR
MMRRC Submission 039260-MU
Accession Numbers

Genbank: NM_016847; MGI: 1859216

Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1188 (G1)
Quality Score187
Status Not validated
Chromosome10
Chromosomal Location122448499-122453452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122448919 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 39 (G39C)
Ref Sequence ENSEMBL: ENSMUSP00000020323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020323]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020323
AA Change: G39C

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020323
Gene: ENSMUSG00000020123
AA Change: G39C

DomainStartEndE-ValueType
Pfam:7tm_4 58 206 8.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 62 362 6.1e-10 PFAM
Pfam:7tm_1 68 353 4.5e-49 PFAM
Pfam:7TM_GPCR_Srv 98 370 1.5e-10 PFAM
DUF1856 377 423 2e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218285
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a receptor for arginine vasopressin, a neurohypophyseal hormone involved in diuresis inhibition, smooth muscle contraction, liver glycogenolysis stimulation and regulation of adrenocorticotropic hormone release from the pituitary. This receptor represents one of three G protein-coupled arginine vasopressin receptors which functions through a phosphotidylinositol-calcium second messenger system in vascular and hepatic tissues [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a stimulus processing deficit similar to that seen in schizophrenia. Anxiety-like behaviors are reduced in males but not females. B cell development is also affected. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Avpr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Avpr1a APN 10 122449351 missense probably benign
IGL01062:Avpr1a APN 10 122449529 missense probably damaging 0.99
IGL01317:Avpr1a APN 10 122449567 missense probably benign
IGL01813:Avpr1a APN 10 122449011 missense probably damaging 1.00
IGL01947:Avpr1a APN 10 122452182 missense probably benign 0.00
IGL02549:Avpr1a APN 10 122452164 missense possibly damaging 0.91
IGL02967:Avpr1a APN 10 122449462 missense possibly damaging 0.95
IGL03114:Avpr1a APN 10 122449718 missense probably damaging 0.99
H8786:Avpr1a UTSW 10 122449468 missense probably benign 0.01
R0211:Avpr1a UTSW 10 122449469 missense possibly damaging 0.54
R0268:Avpr1a UTSW 10 122449709 missense probably damaging 1.00
R1909:Avpr1a UTSW 10 122452208 missense probably benign
R1935:Avpr1a UTSW 10 122449790 critical splice donor site probably null
R2404:Avpr1a UTSW 10 122449210 missense possibly damaging 0.78
R3707:Avpr1a UTSW 10 122449109 missense probably damaging 1.00
R3927:Avpr1a UTSW 10 122449711 missense probably benign 0.00
R4722:Avpr1a UTSW 10 122449001 missense possibly damaging 0.62
R4952:Avpr1a UTSW 10 122449754 missense probably damaging 0.98
R5384:Avpr1a UTSW 10 122449369 missense probably damaging 1.00
R5807:Avpr1a UTSW 10 122449471 missense probably benign 0.14
R6024:Avpr1a UTSW 10 122449148 missense probably damaging 0.99
R7043:Avpr1a UTSW 10 122449681 missense probably damaging 1.00
R7359:Avpr1a UTSW 10 122449378 missense possibly damaging 0.70
R7455:Avpr1a UTSW 10 122449264 missense probably damaging 1.00
Z1088:Avpr1a UTSW 10 122449577 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCAGCCACTAAGATGAGAAGGAGC -3'
(R):5'- GTCATCACCACCAGCATGTAGGAAG -3'

Sequencing Primer
(F):5'- AGGCAGCCTAAGACTGCTTTG -3'
(R):5'- TAGGTGATGTCCCAGCACAG -3'
Posted On2014-01-15