Incidental Mutation 'R1188:R3hdm2'
ID102375
Institutional Source Beutler Lab
Gene Symbol R3hdm2
Ensembl Gene ENSMUSG00000025404
Gene NameR3H domain containing 2
Synonyms
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R1188 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127380327-127499384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127452755 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 91 (V91I)
Ref Sequence ENSEMBL: ENSMUSP00000128659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064793] [ENSMUST00000077046] [ENSMUST00000105249] [ENSMUST00000105250] [ENSMUST00000105251] [ENSMUST00000164161] [ENSMUST00000164831] [ENSMUST00000166820] [ENSMUST00000168780] [ENSMUST00000170336] [ENSMUST00000171434]
Predicted Effect probably benign
Transcript: ENSMUST00000064793
AA Change: V91I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000069724
Gene: ENSMUSG00000025404
AA Change: V91I

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 699 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077046
AA Change: V91I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000076303
Gene: ENSMUSG00000025404
AA Change: V91I

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 7.4e-14 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105249
AA Change: V91I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100884
Gene: ENSMUSG00000025404
AA Change: V91I

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.4e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 692 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105250
AA Change: V91I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100885
Gene: ENSMUSG00000025404
AA Change: V91I

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105251
AA Change: V91I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100886
Gene: ENSMUSG00000025404
AA Change: V91I

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000164161
SMART Domains Protein: ENSMUSP00000126185
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164831
AA Change: V91I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131007
Gene: ENSMUSG00000025404
AA Change: V91I

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 678 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166820
AA Change: V91I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000126608
Gene: ENSMUSG00000025404
AA Change: V91I

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.7e-12 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168780
AA Change: V91I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127872
Gene: ENSMUSG00000025404
AA Change: V91I

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170336
AA Change: V91I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128659
Gene: ENSMUSG00000025404
AA Change: V91I

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 467 N/A INTRINSIC
low complexity region 712 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171434
SMART Domains Protein: ENSMUSP00000131255
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in R3hdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:R3hdm2 APN 10 127458850 missense probably damaging 1.00
IGL02114:R3hdm2 APN 10 127484109 missense probably damaging 0.99
IGL02116:R3hdm2 APN 10 127498552 missense probably damaging 1.00
IGL02549:R3hdm2 APN 10 127484225 splice site probably benign
IGL02647:R3hdm2 APN 10 127459484 missense probably damaging 1.00
IGL02696:R3hdm2 APN 10 127465019 splice site probably null
IGL02732:R3hdm2 APN 10 127484060 missense probably benign 0.43
R0131:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0131:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0132:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0157:R3hdm2 UTSW 10 127471989 missense probably damaging 0.99
R0179:R3hdm2 UTSW 10 127495106 missense probably damaging 1.00
R0196:R3hdm2 UTSW 10 127484521 missense probably damaging 1.00
R0401:R3hdm2 UTSW 10 127458173 missense possibly damaging 0.90
R0505:R3hdm2 UTSW 10 127457700 missense probably damaging 1.00
R0606:R3hdm2 UTSW 10 127444444 missense probably damaging 1.00
R1466:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1466:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1503:R3hdm2 UTSW 10 127471826 nonsense probably null
R1584:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1652:R3hdm2 UTSW 10 127495091 missense probably benign 0.00
R1901:R3hdm2 UTSW 10 127498468 missense possibly damaging 0.91
R3735:R3hdm2 UTSW 10 127465010 missense probably benign
R5261:R3hdm2 UTSW 10 127498416 missense probably damaging 1.00
R5329:R3hdm2 UTSW 10 127458893 missense probably damaging 1.00
R5379:R3hdm2 UTSW 10 127471902 missense probably damaging 1.00
R5380:R3hdm2 UTSW 10 127485447 missense probably damaging 1.00
R5387:R3hdm2 UTSW 10 127485434 missense probably damaging 1.00
R5558:R3hdm2 UTSW 10 127444402 missense probably damaging 1.00
R5773:R3hdm2 UTSW 10 127444303 utr 5 prime probably benign
R5936:R3hdm2 UTSW 10 127471812 missense probably damaging 1.00
R6024:R3hdm2 UTSW 10 127459480 missense probably damaging 1.00
R6160:R3hdm2 UTSW 10 127484507 missense probably damaging 1.00
R6191:R3hdm2 UTSW 10 127484515 missense probably damaging 1.00
R7058:R3hdm2 UTSW 10 127484513 missense probably damaging 1.00
R7224:R3hdm2 UTSW 10 127458153 missense probably damaging 1.00
R7253:R3hdm2 UTSW 10 127481775 missense probably damaging 1.00
R7305:R3hdm2 UTSW 10 127476678 missense probably benign 0.08
R7349:R3hdm2 UTSW 10 127492646 missense probably benign
R7431:R3hdm2 UTSW 10 127458147 missense probably benign 0.16
R7891:R3hdm2 UTSW 10 127498574 missense probably benign 0.07
R8503:R3hdm2 UTSW 10 127492612 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTAAACATTCACCAAAGGGGTGTGTG -3'
(R):5'- GATGTGTTCAGCCCCAGGTCC -3'

Sequencing Primer
(F):5'- Ggtgtgtgtgtttgtgtgtg -3'
(R):5'- agccatctctccagtccc -3'
Posted On2014-01-15