Incidental Mutation 'R1188:Zbtb39'
ID102377
Institutional Source Beutler Lab
Gene Symbol Zbtb39
Ensembl Gene ENSMUSG00000044617
Gene Namezinc finger and BTB domain containing 39
Synonyms
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R1188 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127739538-127747349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 127742306 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 250 (Q250E)
Ref Sequence ENSEMBL: ENSMUSP00000052717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054287] [ENSMUST00000079692]
Predicted Effect probably benign
Transcript: ENSMUST00000054287
AA Change: Q250E

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000052717
Gene: ENSMUSG00000044617
AA Change: Q250E

DomainStartEndE-ValueType
BTB 30 126 9.15e-24 SMART
low complexity region 197 206 N/A INTRINSIC
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 372 394 6.4e0 SMART
ZnF_C2H2 400 420 3.21e1 SMART
ZnF_C2H2 451 474 9.31e1 SMART
ZnF_C2H2 480 502 6.92e0 SMART
ZnF_C2H2 508 530 1.79e-2 SMART
ZnF_C2H2 538 560 1.18e-2 SMART
ZnF_C2H2 605 627 2.57e-3 SMART
ZnF_C2H2 633 655 3.78e-1 SMART
ZnF_C2H2 661 683 2.49e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079692
SMART Domains Protein: ENSMUSP00000100882
Gene: ENSMUSG00000058396

DomainStartEndE-ValueType
Pfam:7tm_1 66 316 1.2e-40 PFAM
low complexity region 340 352 N/A INTRINSIC
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Other mutations in Zbtb39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Zbtb39 APN 10 127742366 missense probably benign 0.00
R0636:Zbtb39 UTSW 10 127742835 missense probably benign 0.01
R0959:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R0959:Zbtb39 UTSW 10 127743062 missense probably damaging 1.00
R0962:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R0964:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R1189:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R1239:Zbtb39 UTSW 10 127743069 missense probably damaging 1.00
R1341:Zbtb39 UTSW 10 127743500 missense possibly damaging 0.91
R1838:Zbtb39 UTSW 10 127742700 missense probably damaging 1.00
R2012:Zbtb39 UTSW 10 127742834 missense probably benign 0.43
R2167:Zbtb39 UTSW 10 127742975 missense probably benign 0.03
R2346:Zbtb39 UTSW 10 127741581 missense possibly damaging 0.49
R4041:Zbtb39 UTSW 10 127743554 missense probably damaging 1.00
R4171:Zbtb39 UTSW 10 127742367 missense possibly damaging 0.51
R4409:Zbtb39 UTSW 10 127742827 missense possibly damaging 0.51
R4410:Zbtb39 UTSW 10 127742827 missense possibly damaging 0.51
R4539:Zbtb39 UTSW 10 127742192 missense possibly damaging 0.90
R5761:Zbtb39 UTSW 10 127742646 missense probably damaging 1.00
R5766:Zbtb39 UTSW 10 127742688 missense probably damaging 1.00
R5812:Zbtb39 UTSW 10 127741560 start codon destroyed probably null 0.99
R6710:Zbtb39 UTSW 10 127743636 missense probably damaging 1.00
R6919:Zbtb39 UTSW 10 127741842 missense probably damaging 1.00
R7941:Zbtb39 UTSW 10 127743540 missense probably damaging 1.00
X0024:Zbtb39 UTSW 10 127741766 missense probably damaging 1.00
Z1177:Zbtb39 UTSW 10 127742427 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGACACTAATCATGGCTTGCCCC -3'
(R):5'- GCTGTCGTCGCTCAACTCAATCAC -3'

Sequencing Primer
(F):5'- TCTGTTCCTAGTGTGGCAAC -3'
(R):5'- GCGGTCCCGATGTCTTC -3'
Posted On2014-01-15