Incidental Mutation 'R1188:Tshr'
ID102381
Institutional Source Beutler Lab
Gene Symbol Tshr
Ensembl Gene ENSMUSG00000020963
Gene Namethyroid stimulating hormone receptor
Synonymspet, hyt, hypothroid
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R1188 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location91384563-91549808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91502168 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 18 (D18E)
Ref Sequence ENSEMBL: ENSMUSP00000152158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021343] [ENSMUST00000021346] [ENSMUST00000221216]
Predicted Effect probably benign
Transcript: ENSMUST00000021343
AA Change: D120E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021343
Gene: ENSMUSG00000020963
AA Change: D120E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:LRR_5 53 143 1e-6 PFAM
Pfam:LRR_5 137 228 3.8e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021346
AA Change: D120E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021346
Gene: ENSMUSG00000020963
AA Change: D120E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:LRR_5 53 153 9.5e-7 PFAM
Pfam:LRR_5 148 244 5.1e-5 PFAM
Pfam:7tm_1 431 678 2.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221216
AA Change: D18E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene exhibit profound hypothyroidism, developmental and growth retardation, impaired hearing with cochlear defects, and infertility. One mutation results in high postweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Tshr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Tshr APN 12 91537500 missense probably damaging 1.00
IGL01503:Tshr APN 12 91511934 missense probably damaging 1.00
IGL01730:Tshr APN 12 91519303 missense possibly damaging 0.93
IGL02109:Tshr APN 12 91537992 missense probably damaging 1.00
IGL02199:Tshr APN 12 91538283 missense probably damaging 1.00
IGL02439:Tshr APN 12 91537547 missense probably damaging 0.97
IGL02696:Tshr APN 12 91493329 missense possibly damaging 0.72
IGL03170:Tshr APN 12 91537869 missense probably damaging 1.00
IGL03208:Tshr APN 12 91533942 missense probably damaging 1.00
freckle UTSW 12 91538226 nonsense probably null
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0067:Tshr UTSW 12 91505283 missense probably damaging 1.00
R0419:Tshr UTSW 12 91537869 missense probably damaging 1.00
R0658:Tshr UTSW 12 91538226 nonsense probably null
R0724:Tshr UTSW 12 91538286 missense probably damaging 1.00
R1170:Tshr UTSW 12 91538097 missense probably damaging 1.00
R1548:Tshr UTSW 12 91534031 missense probably damaging 1.00
R1677:Tshr UTSW 12 91537341 missense possibly damaging 0.81
R1808:Tshr UTSW 12 91537316 missense probably benign 0.00
R1934:Tshr UTSW 12 91537181 missense probably damaging 0.99
R3980:Tshr UTSW 12 91537743 missense probably damaging 1.00
R4008:Tshr UTSW 12 91537494 missense probably benign 0.21
R4828:Tshr UTSW 12 91537790 missense probably damaging 1.00
R4903:Tshr UTSW 12 91401188 missense probably benign 0.09
R4958:Tshr UTSW 12 91538187 missense probably damaging 1.00
R5528:Tshr UTSW 12 91537193 missense probably damaging 1.00
R5949:Tshr UTSW 12 91537218 missense probably damaging 1.00
R6136:Tshr UTSW 12 91538234 missense probably benign 0.34
R6147:Tshr UTSW 12 91538235 missense possibly damaging 0.84
R6454:Tshr UTSW 12 91538549 missense probably benign 0.33
R6572:Tshr UTSW 12 91538360 missense probably benign 0.29
R6884:Tshr UTSW 12 91538102 missense probably damaging 1.00
R6986:Tshr UTSW 12 91533957 missense probably damaging 0.97
R7403:Tshr UTSW 12 91497774 missense probably damaging 1.00
R7691:Tshr UTSW 12 91497741 missense probably benign 0.00
R7741:Tshr UTSW 12 91533969 nonsense probably null
R7769:Tshr UTSW 12 91538270 missense probably damaging 1.00
R7784:Tshr UTSW 12 91505305 missense probably benign 0.02
R7934:Tshr UTSW 12 91511928 missense possibly damaging 0.88
R8060:Tshr UTSW 12 91538360 missense probably benign 0.12
R8168:Tshr UTSW 12 91511965 missense probably benign 0.19
Z1176:Tshr UTSW 12 91538491 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ACATGAAGTCCCTGTCCTACCACATAA -3'
(R):5'- TGCCATACACGAGTCAAATGATGACAA -3'

Sequencing Primer
(F):5'- AAGTACATCAGCGTCTTTTTGTG -3'
(R):5'- acacacacacacagagacac -3'
Posted On2014-01-15