Incidental Mutation 'R1188:Gpr20'
ID102387
Institutional Source Beutler Lab
Gene Symbol Gpr20
Ensembl Gene ENSMUSG00000045281
Gene NameG protein-coupled receptor 20
Synonyms
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1188 (G1)
Quality Score123
Status Not validated
Chromosome15
Chromosomal Location73694604-73707505 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73695768 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 257 (H257Q)
Ref Sequence ENSEMBL: ENSMUSP00000063910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064166]
Predicted Effect probably damaging
Transcript: ENSMUST00000064166
AA Change: H257Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063910
Gene: ENSMUSG00000045281
AA Change: H257Q

DomainStartEndE-ValueType
Pfam:7tm_1 68 296 7.7e-32 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Gpr20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Gpr20 APN 15 73696420 missense probably damaging 1.00
IGL02312:Gpr20 APN 15 73696426 missense probably benign 0.00
I1329:Gpr20 UTSW 15 73695763 missense probably damaging 1.00
R1604:Gpr20 UTSW 15 73696004 missense probably damaging 0.98
R1687:Gpr20 UTSW 15 73695902 missense probably benign 0.21
R4398:Gpr20 UTSW 15 73696276 missense probably benign
R4436:Gpr20 UTSW 15 73695800 missense probably benign 0.06
R4505:Gpr20 UTSW 15 73696472 missense probably benign 0.03
R4615:Gpr20 UTSW 15 73695736 missense probably benign
R4616:Gpr20 UTSW 15 73695736 missense probably benign
R4617:Gpr20 UTSW 15 73695736 missense probably benign
R4618:Gpr20 UTSW 15 73695736 missense probably benign
R6120:Gpr20 UTSW 15 73696004 missense probably damaging 0.98
R7224:Gpr20 UTSW 15 73696132 missense probably damaging 1.00
R8313:Gpr20 UTSW 15 73696312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGACCACATCCATACTGCTG -3'
(R):5'- GATCATGCTGCCGTGTCTTTGC -3'

Sequencing Primer
(F):5'- GAATTCTTCTCCACGCTGGTAG -3'
(R):5'- TTGCTCTGACCGTTCTGG -3'
Posted On2014-01-15