Incidental Mutation 'R1188:Amigo2'
ID102390
Institutional Source Beutler Lab
Gene Symbol Amigo2
Ensembl Gene ENSMUSG00000048218
Gene Nameadhesion molecule with Ig like domain 2
Synonyms
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R1188 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location97244125-97247287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97245713 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 276 (E276V)
Ref Sequence ENSEMBL: ENSMUSP00000155019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053106] [ENSMUST00000059433] [ENSMUST00000229890]
Predicted Effect probably benign
Transcript: ENSMUST00000053106
AA Change: E276V

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059913
Gene: ENSMUSG00000048218
AA Change: E276V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 39 71 7e-1 SMART
LRR 91 114 2.63e0 SMART
LRR 115 138 6.96e0 SMART
LRR_TYP 139 162 4.47e-3 SMART
LRR 163 186 1.07e0 SMART
LRR 190 214 1.06e2 SMART
LRRCT 227 282 4.74e-3 SMART
IGc2 300 369 9.34e-4 SMART
transmembrane domain 397 419 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
low complexity region 501 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059433
SMART Domains Protein: ENSMUSP00000055485
Gene: ENSMUSG00000044250

DomainStartEndE-ValueType
Pfam:PC-Esterase 1 254 5.1e-53 PFAM
low complexity region 295 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226615
Predicted Effect probably benign
Transcript: ENSMUST00000229890
AA Change: E276V

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Amigo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Amigo2 APN 15 97245446 missense possibly damaging 0.84
IGL01451:Amigo2 APN 15 97245226 missense probably benign 0.22
IGL01510:Amigo2 APN 15 97245081 missense probably benign
IGL02496:Amigo2 APN 15 97245613 nonsense probably null
IGL02720:Amigo2 APN 15 97245697 nonsense probably null
R0288:Amigo2 UTSW 15 97245679 missense probably damaging 1.00
R0377:Amigo2 UTSW 15 97246380 missense possibly damaging 0.93
R0696:Amigo2 UTSW 15 97245974 missense probably benign 0.00
R1639:Amigo2 UTSW 15 97245998 missense probably benign 0.10
R3076:Amigo2 UTSW 15 97245434 missense probably damaging 0.98
R3837:Amigo2 UTSW 15 97245315 missense probably damaging 0.99
R4378:Amigo2 UTSW 15 97245978 missense possibly damaging 0.69
R5196:Amigo2 UTSW 15 97246061 missense probably damaging 1.00
R5698:Amigo2 UTSW 15 97245726 nonsense probably null
R6191:Amigo2 UTSW 15 97245538 missense probably benign 0.42
R6326:Amigo2 UTSW 15 97245375 missense probably benign 0.00
R6738:Amigo2 UTSW 15 97245464 missense possibly damaging 0.82
R7102:Amigo2 UTSW 15 97245860 missense probably damaging 1.00
R7253:Amigo2 UTSW 15 97245075 missense probably benign 0.03
R7615:Amigo2 UTSW 15 97245342 missense probably damaging 1.00
R8269:Amigo2 UTSW 15 97246231 missense possibly damaging 0.84
R8304:Amigo2 UTSW 15 97246157 missense probably damaging 1.00
R8333:Amigo2 UTSW 15 97245285 missense probably damaging 1.00
X0018:Amigo2 UTSW 15 97245893 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGCGATACAAGAATATACCCCGGC -3'
(R):5'- AGAGGCATCTACCTTCACGGGAAC -3'

Sequencing Primer
(F):5'- TCAAAGCCAGGGTTCTCTATGAC -3'
(R):5'- CACGGGAACCCATTTGTATG -3'
Posted On2014-01-15