Incidental Mutation 'R1188:Prkag1'
ID102392
Institutional Source Beutler Lab
Gene Symbol Prkag1
Ensembl Gene ENSMUSG00000067713
Gene Nameprotein kinase, AMP-activated, gamma 1 non-catalytic subunit
SynonymsPrkaac
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R1188 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98812797-98831521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98814598 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 118 (I118F)
Ref Sequence ENSEMBL: ENSMUSP00000155591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168846] [ENSMUST00000229297] [ENSMUST00000230560]
Predicted Effect probably damaging
Transcript: ENSMUST00000168846
AA Change: I149F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132499
Gene: ENSMUSG00000067713
AA Change: I149F

DomainStartEndE-ValueType
CBS 46 95 8.18e-7 SMART
CBS 127 176 3.12e-12 SMART
CBS 202 250 1.01e-11 SMART
CBS 274 322 2.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181510
Predicted Effect probably damaging
Transcript: ENSMUST00000229297
AA Change: I118F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230113
Predicted Effect possibly damaging
Transcript: ENSMUST00000230560
AA Change: I118F

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hemolytic anemia, extramedullary hematopoiesis, and iron accumulation in the spleen, liver, and Kupffer cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Prkag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Prkag1 APN 15 98814531 missense probably damaging 1.00
IGL02621:Prkag1 APN 15 98814028 missense probably damaging 1.00
IGL02804:Prkag1 APN 15 98815504 missense probably damaging 1.00
IGL03197:Prkag1 APN 15 98815177 splice site probably benign
R0328:Prkag1 UTSW 15 98815682 missense probably damaging 1.00
R1493:Prkag1 UTSW 15 98813670 missense probably benign 0.02
R1663:Prkag1 UTSW 15 98815895 missense probably damaging 1.00
R2115:Prkag1 UTSW 15 98814552 missense probably damaging 1.00
R2216:Prkag1 UTSW 15 98815946 start codon destroyed probably null 1.00
R5037:Prkag1 UTSW 15 98815887 missense possibly damaging 0.51
R5175:Prkag1 UTSW 15 98815715 missense possibly damaging 0.82
R5597:Prkag1 UTSW 15 98815908 missense probably damaging 1.00
R6185:Prkag1 UTSW 15 98825714 missense probably benign 0.00
R6359:Prkag1 UTSW 15 98814552 missense probably damaging 1.00
R6429:Prkag1 UTSW 15 98814523 missense probably damaging 1.00
R7777:Prkag1 UTSW 15 98814597 missense probably damaging 1.00
R8432:Prkag1 UTSW 15 98815544 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGCTGTACAAAGATGCCCAGAGCC -3'
(R):5'- AGTTACCAGTTCATGCCCAGCCAC -3'

Sequencing Primer
(F):5'- GACTTAGACATGAATTCCGGC -3'
(R):5'- tgcccagccacacacag -3'
Posted On2014-01-15