Incidental Mutation 'R1188:Rnf168'
ID102394
Institutional Source Beutler Lab
Gene Symbol Rnf168
Ensembl Gene ENSMUSG00000014074
Gene Namering finger protein 168
Synonyms3110001H15Rik
MMRRC Submission 039260-MU
Accession Numbers

Ncbi RefSeq: NM_027355.2; MGI:1917488

Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock #R1188 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32277459-32301434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32298659 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 346 (V346A)
Ref Sequence ENSEMBL: ENSMUSP00000126484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014218] [ENSMUST00000171474]
Predicted Effect probably benign
Transcript: ENSMUST00000014218
AA Change: V344A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000014218
Gene: ENSMUSG00000014074
AA Change: V344A

DomainStartEndE-ValueType
RING 16 54 8.23e-6 SMART
coiled coil region 114 184 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171474
AA Change: V346A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000126484
Gene: ENSMUSG00000014074
AA Change: V346A

DomainStartEndE-ValueType
RING 18 56 8.23e-6 SMART
coiled coil region 116 186 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase protein that contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The protein is involved in DNA double-strand break (DSB) repair. Mutations in this gene result in Riddle syndrome. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit immunodeficient, increased radiosensitivity and age-dependent reduction in male infertility. [provided by MGI curators]
Allele List at MGI

All alleles(56) : Gene trapped(56)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Rnf168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02997:Rnf168 APN 16 32285421 missense probably damaging 1.00
IGL03108:Rnf168 APN 16 32278281 missense possibly damaging 0.79
P0021:Rnf168 UTSW 16 32298887 missense probably damaging 0.96
R0038:Rnf168 UTSW 16 32298995 missense probably benign 0.05
R0038:Rnf168 UTSW 16 32298995 missense probably benign 0.05
R0040:Rnf168 UTSW 16 32278173 splice site probably null
R0049:Rnf168 UTSW 16 32298469 missense possibly damaging 0.56
R0049:Rnf168 UTSW 16 32298469 missense possibly damaging 0.56
R0760:Rnf168 UTSW 16 32298386 critical splice acceptor site probably null
R1386:Rnf168 UTSW 16 32298963 missense probably damaging 1.00
R1754:Rnf168 UTSW 16 32299124 missense probably benign
R2118:Rnf168 UTSW 16 32278218 missense probably damaging 1.00
R2122:Rnf168 UTSW 16 32278218 missense probably damaging 1.00
R2124:Rnf168 UTSW 16 32278218 missense probably damaging 1.00
R2520:Rnf168 UTSW 16 32278403 missense probably benign 0.17
R2852:Rnf168 UTSW 16 32282374 missense probably damaging 0.99
R3418:Rnf168 UTSW 16 32299192 missense probably benign 0.00
R3419:Rnf168 UTSW 16 32299192 missense probably benign 0.00
R4886:Rnf168 UTSW 16 32299196 missense probably benign 0.00
R5335:Rnf168 UTSW 16 32298584 missense possibly damaging 0.78
R5738:Rnf168 UTSW 16 32282374 missense probably damaging 0.99
R6570:Rnf168 UTSW 16 32289210 missense probably benign 0.00
R7165:Rnf168 UTSW 16 32282361 missense probably benign 0.38
R7529:Rnf168 UTSW 16 32298914 missense probably damaging 0.98
R7556:Rnf168 UTSW 16 32299045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCCTGGAAACTCAAGAACAAGG -3'
(R):5'- TCTGCCGGTTTGGCACCATTTG -3'

Sequencing Primer
(F):5'- AACAAGGTTCGGAGTCTTCTGC -3'
(R):5'- GTAATGCTAACAATCTGTCCTGC -3'
Posted On2014-01-15