Incidental Mutation 'R1188:Jam2'
ID102395
Institutional Source Beutler Lab
Gene Symbol Jam2
Ensembl Gene ENSMUSG00000053062
Gene Namejunction adhesion molecule 2
SynonymsJAM-2, Jcam2, 2410030G21Rik, 2410167M24Rik, VE-JAM
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1188 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location84774123-84825928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84806867 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 81 (T81A)
Ref Sequence ENSEMBL: ENSMUSP00000156235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098407] [ENSMUST00000114195] [ENSMUST00000231910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098407
AA Change: T57A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096007
Gene: ENSMUSG00000053062
AA Change: T57A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 36 132 7.7e-5 SMART
low complexity region 170 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114195
AA Change: T57A

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109833
Gene: ENSMUSG00000053062
AA Change: T57A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 36 132 7.7e-5 SMART
IGc2 147 221 1.06e-11 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138054
Predicted Effect probably damaging
Transcript: ENSMUST00000231910
AA Change: T81A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the immunoglobulin superfamily, and the junctional adhesion molecule (JAM) family. The protein encoded by this gene is a type I membrane protein that is localized at the tight junctions of both epithelial and endothelial cells. It acts as an adhesive ligand for interacting with a variety of immune cell types, and may play a role in lymphocyte homing to secondary lymphoid organs. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal with no detectable spermatogenesis abnormalities or defects in embryonic, neural and hematopoietic stem cell properties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Jam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Jam2 APN 16 84822824 utr 3 prime probably benign
IGL00805:Jam2 APN 16 84815166 splice site probably benign
R0834:Jam2 UTSW 16 84812967 missense probably damaging 1.00
R4230:Jam2 UTSW 16 84821292 missense possibly damaging 0.92
R4323:Jam2 UTSW 16 84822856 utr 3 prime probably benign
R4659:Jam2 UTSW 16 84812952 missense probably damaging 0.96
R4660:Jam2 UTSW 16 84812952 missense probably damaging 0.96
R4662:Jam2 UTSW 16 84812952 missense probably damaging 0.96
R4679:Jam2 UTSW 16 84812952 missense probably damaging 0.96
R4741:Jam2 UTSW 16 84812952 missense probably damaging 0.96
R4856:Jam2 UTSW 16 84801602 missense probably benign 0.39
R4929:Jam2 UTSW 16 84822862 utr 3 prime probably benign
R4961:Jam2 UTSW 16 84809547 nonsense probably null
R5915:Jam2 UTSW 16 84809407 missense probably benign 0.01
R7779:Jam2 UTSW 16 84809383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCGTCATGCTCCCAATTC -3'
(R):5'- TGTTAAGCGAGCAATGGTCCCAG -3'

Sequencing Primer
(F):5'- CCCTACAGACATGATGTACTTATGC -3'
(R):5'- AGGGGACCTCACCTTTTTCG -3'
Posted On2014-01-15