Incidental Mutation 'R1189:Aldh1a2'
ID102421
Institutional Source Beutler Lab
Gene Symbol Aldh1a2
Ensembl Gene ENSMUSG00000013584
Gene Namealdehyde dehydrogenase family 1, subfamily A2
Synonymsretinaldehyde dehydrogenase, Aldh1a7, Raldh2
MMRRC Submission 039261-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1189 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location71215789-71296243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 71263823 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 198 (A198S)
Ref Sequence ENSEMBL: ENSMUSP00000034723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034723]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034723
AA Change: A198S

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034723
Gene: ENSMUSG00000013584
AA Change: A198S

DomainStartEndE-ValueType
Pfam:Aldedh 46 509 2.5e-187 PFAM
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.2%
  • 10x: 92.5%
  • 20x: 81.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. The product of this gene is an enzyme that catalyzes the synthesis of retinoic acid (RA) from retinaldehyde. Retinoic acid, the active derivative of vitamin A (retinol), is a hormonal signaling molecule that functions in developing and adult tissues. The studies of a similar mouse gene suggest that this enzyme and the cytochrome CYP26A1, concurrently establish local embryonic retinoic acid levels which facilitate posterior organ development and prevent spina bifida. Four transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygotes for null mutations are largely devoid of retinoic acid and die by embryonic day 10.5 with impaired hindbrain development, failure to turn, lack of limb buds, heart abnormalities, reduced otocysts and a truncated frontonasal region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930022D16Rik A G 11: 109,418,108 H100R unknown Het
Abcc2 T A 19: 43,819,413 V831D probably damaging Het
Akap11 A T 14: 78,513,347 S533R probably benign Het
Cbarp C A 10: 80,131,796 R537L possibly damaging Het
Crybg1 T A 10: 43,998,794 S773C probably damaging Het
Cyp3a13 G T 5: 137,911,630 probably null Het
Gatad1 T A 5: 3,643,701 D156V probably damaging Het
Ift172 T A 5: 31,285,830 probably null Het
Lrrtm2 C T 18: 35,213,492 W252* probably null Het
Mitf T C 6: 98,006,125 C270R possibly damaging Het
Muc6 T A 7: 141,645,855 S1002C probably damaging Het
Olfr1467 A T 19: 13,365,179 M184L probably benign Het
Olfr730 A G 14: 50,187,082 I45T probably damaging Het
Pcdhb8 C T 18: 37,356,567 Q92* probably null Het
Plekhm1 A G 11: 103,387,062 S403P probably benign Het
Ppara A G 15: 85,798,164 I354V probably benign Het
Psmd2 T C 16: 20,661,894 M761T probably benign Het
Xirp2 T A 2: 67,513,461 N2015K probably damaging Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Aldh1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Aldh1a2 APN 9 71215969 splice site probably benign
IGL01327:Aldh1a2 APN 9 71285966 missense possibly damaging 0.95
IGL02293:Aldh1a2 APN 9 71285277 splice site probably null
IGL03380:Aldh1a2 APN 9 71255117 nonsense probably null
R0574:Aldh1a2 UTSW 9 71281708 critical splice donor site probably null
R1217:Aldh1a2 UTSW 9 71281682 missense possibly damaging 0.94
R1270:Aldh1a2 UTSW 9 71281706 missense probably benign 0.03
R1445:Aldh1a2 UTSW 9 71285210 missense possibly damaging 0.82
R1717:Aldh1a2 UTSW 9 71293671 missense probably damaging 0.99
R1737:Aldh1a2 UTSW 9 71285171 missense possibly damaging 0.56
R1755:Aldh1a2 UTSW 9 71261741 nonsense probably null
R1984:Aldh1a2 UTSW 9 71253052 missense probably damaging 1.00
R2248:Aldh1a2 UTSW 9 71215862 missense possibly damaging 0.90
R2407:Aldh1a2 UTSW 9 71252598 missense probably damaging 0.99
R3772:Aldh1a2 UTSW 9 71252920 missense probably damaging 1.00
R4945:Aldh1a2 UTSW 9 71215916 missense probably benign 0.00
R5042:Aldh1a2 UTSW 9 71285004 missense possibly damaging 0.69
R5066:Aldh1a2 UTSW 9 71281700 missense possibly damaging 0.82
R5406:Aldh1a2 UTSW 9 71255121 missense possibly damaging 0.93
R5425:Aldh1a2 UTSW 9 71253004 missense probably benign 0.00
R5588:Aldh1a2 UTSW 9 71283450 missense probably damaging 1.00
R6048:Aldh1a2 UTSW 9 71261767 missense probably damaging 0.98
R6455:Aldh1a2 UTSW 9 71252914 critical splice acceptor site probably null
R6642:Aldh1a2 UTSW 9 71252986 missense probably damaging 1.00
R7253:Aldh1a2 UTSW 9 71215934 missense probably benign
R7514:Aldh1a2 UTSW 9 71284963 missense probably damaging 1.00
R7981:Aldh1a2 UTSW 9 71263820 missense probably damaging 1.00
RF018:Aldh1a2 UTSW 9 71285270 missense probably damaging 1.00
Z1177:Aldh1a2 UTSW 9 71283522 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CAAGGTCTACACTTGGTGGCAGAG -3'
(R):5'- CATACCCTGGCAGGATATTGACGAC -3'

Sequencing Primer
(F):5'- CTACACTTGGTGGCAGAGATAATC -3'
(R):5'- ggtgtgtgttatatcccccttc -3'
Posted On2014-01-15