Incidental Mutation 'R1148:Olfr1009'
ID102511
Institutional Source Beutler Lab
Gene Symbol Olfr1009
Ensembl Gene ENSMUSG00000043226
Gene Nameolfactory receptor 1009
SynonymsMOR175-3, GA_x6K02T2Q125-47195323-47196267
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1148 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85715419-85725136 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 85722276 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 290 (Y290*)
Ref Sequence ENSEMBL: ENSMUSP00000150450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055517] [ENSMUST00000216443]
Predicted Effect probably null
Transcript: ENSMUST00000055517
AA Change: Y290*
SMART Domains Protein: ENSMUSP00000061475
Gene: ENSMUSG00000043226
AA Change: Y290*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.4e-55 PFAM
Pfam:7tm_1 41 290 4.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213600
Predicted Effect probably null
Transcript: ENSMUST00000216443
AA Change: Y290*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in Olfr1009
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Olfr1009 APN 2 85722239 missense probably damaging 1.00
IGL01862:Olfr1009 APN 2 85722128 missense probably damaging 0.99
IGL02868:Olfr1009 APN 2 85721575 missense probably benign 0.19
IGL02904:Olfr1009 APN 2 85721755 missense probably damaging 0.99
IGL03240:Olfr1009 APN 2 85722331 nonsense probably null
IGL03347:Olfr1009 APN 2 85721807 missense probably benign 0.01
R1148:Olfr1009 UTSW 2 85722276 nonsense probably null
R1446:Olfr1009 UTSW 2 85721573 missense probably damaging 0.99
R3782:Olfr1009 UTSW 2 85721696 missense probably damaging 1.00
R4343:Olfr1009 UTSW 2 85722248 missense probably damaging 1.00
R4836:Olfr1009 UTSW 2 85721449 missense probably benign
R4845:Olfr1009 UTSW 2 85721492 nonsense probably null
R5490:Olfr1009 UTSW 2 85722322 missense probably benign 0.01
R5534:Olfr1009 UTSW 2 85721987 missense probably benign 0.35
R5679:Olfr1009 UTSW 2 85722046 missense probably damaging 1.00
R6476:Olfr1009 UTSW 2 85721584 missense probably damaging 1.00
R6701:Olfr1009 UTSW 2 85722331 missense probably benign 0.28
R7024:Olfr1009 UTSW 2 85721608 missense probably damaging 1.00
R7140:Olfr1009 UTSW 2 85721474 missense probably damaging 0.97
R7174:Olfr1009 UTSW 2 85721953 missense possibly damaging 0.81
X0020:Olfr1009 UTSW 2 85721978 missense probably damaging 1.00
Predicted Primers
Posted On2014-01-15