Incidental Mutation 'R1148:Sh3d19'
ID102513
Institutional Source Beutler Lab
Gene Symbol Sh3d19
Ensembl Gene ENSMUSG00000028082
Gene NameSH3 domain protein D19
SynonymsKryn
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1148 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location85971109-86130526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86107327 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 475 (D475G)
Ref Sequence ENSEMBL: ENSMUSP00000138320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107664] [ENSMUST00000182666]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107664
AA Change: D475G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103291
Gene: ENSMUSG00000028082
AA Change: D475G

DomainStartEndE-ValueType
low complexity region 336 361 N/A INTRINSIC
SH3 417 472 1.33e-3 SMART
SH3 497 552 1.88e-21 SMART
SH3 573 628 3.99e-16 SMART
SH3 663 718 2.8e-20 SMART
SH3 732 787 7.62e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182666
AA Change: D475G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138320
Gene: ENSMUSG00000028082
AA Change: D475G

DomainStartEndE-ValueType
low complexity region 336 361 N/A INTRINSIC
SH3 417 472 1.33e-3 SMART
SH3 497 552 1.88e-21 SMART
SH3 573 628 3.99e-16 SMART
SH3 663 718 2.8e-20 SMART
SH3 732 787 7.62e-22 SMART
Meta Mutation Damage Score 0.1781 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multiple SH3 domain-containing protein, which interacts with other proteins, such as EBP and members of ADAM family, via the SH3 domains. This protein may be involved in suppression of Ras-induced cellular transformation and Ras-mediated activation of ELK1 by EBP, and regulation of ADAM proteins in the signaling of EGFR-ligand shedding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in Sh3d19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Sh3d19 APN 3 86098185 missense probably benign 0.01
IGL01483:Sh3d19 APN 3 86114796 missense probably benign 0.09
IGL02272:Sh3d19 APN 3 86121167 missense probably benign 0.02
IGL02308:Sh3d19 APN 3 86093710 missense probably damaging 0.98
IGL02431:Sh3d19 APN 3 86106998 missense probably damaging 1.00
R0277:Sh3d19 UTSW 3 86126671 missense probably benign 0.00
R0323:Sh3d19 UTSW 3 86126671 missense probably benign 0.00
R0624:Sh3d19 UTSW 3 86114906 missense possibly damaging 0.96
R0639:Sh3d19 UTSW 3 86106973 missense probably benign 0.00
R0673:Sh3d19 UTSW 3 86106973 missense probably benign 0.00
R1148:Sh3d19 UTSW 3 86107327 missense possibly damaging 0.82
R1569:Sh3d19 UTSW 3 86126644 missense possibly damaging 0.83
R1738:Sh3d19 UTSW 3 86120606 missense probably damaging 1.00
R3911:Sh3d19 UTSW 3 86107227 missense possibly damaging 0.62
R3913:Sh3d19 UTSW 3 86084776 missense probably damaging 0.97
R4246:Sh3d19 UTSW 3 86126688 missense probably benign 0.06
R4327:Sh3d19 UTSW 3 86123713 missense probably benign
R4663:Sh3d19 UTSW 3 86123263 missense probably benign 0.06
R4730:Sh3d19 UTSW 3 86116864 missense possibly damaging 0.89
R4812:Sh3d19 UTSW 3 86123767 missense probably damaging 1.00
R4841:Sh3d19 UTSW 3 86123742 missense probably damaging 1.00
R4842:Sh3d19 UTSW 3 86123742 missense probably damaging 1.00
R5814:Sh3d19 UTSW 3 86126604 missense probably benign 0.00
R6279:Sh3d19 UTSW 3 86104102 missense possibly damaging 0.77
R6504:Sh3d19 UTSW 3 86085336 missense probably benign
R6806:Sh3d19 UTSW 3 86104333 missense probably damaging 0.99
R6916:Sh3d19 UTSW 3 86084911 missense probably benign 0.03
R7012:Sh3d19 UTSW 3 86085013 missense probably benign 0.01
R7147:Sh3d19 UTSW 3 86104277 missense possibly damaging 0.71
R7367:Sh3d19 UTSW 3 86104228 missense probably benign 0.21
R7590:Sh3d19 UTSW 3 86114906 missense possibly damaging 0.96
R7739:Sh3d19 UTSW 3 86123731 missense probably benign
X0027:Sh3d19 UTSW 3 86120703 missense probably damaging 1.00
Predicted Primers
Posted On2014-01-15