Incidental Mutation 'R1148:Cyp4x1'
ID102514
Institutional Source Beutler Lab
Gene Symbol Cyp4x1
Ensembl Gene ENSMUSG00000047155
Gene Namecytochrome P450, family 4, subfamily x, polypeptide 1
SynonymsCyp4a28-ps
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1148 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115106323-115134281 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 115126555 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051400] [ENSMUST00000106545]
Predicted Effect probably benign
Transcript: ENSMUST00000051400
SMART Domains Protein: ENSMUSP00000059545
Gene: ENSMUSG00000047155

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
Pfam:p450 46 501 1.5e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106545
SMART Domains Protein: ENSMUSP00000102155
Gene: ENSMUSG00000047155

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:p450 20 475 4.7e-118 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes and is located within a cluster of genes belonging to this superfamily on chromosome 1. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The expression pattern of a similar rat protein suggests that this protein may be involved in neurovascular function in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in Cyp4x1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cyp4x1 APN 4 115121948 missense probably benign 0.00
IGL00913:Cyp4x1 APN 4 115112863 missense probably benign 0.19
IGL02990:Cyp4x1 APN 4 115121749 missense probably benign 0.02
IGL03411:Cyp4x1 APN 4 115108785 missense probably benign 0.05
R0607:Cyp4x1 UTSW 4 115112826 missense probably damaging 1.00
R1148:Cyp4x1 UTSW 4 115126555 splice site probably benign
R1426:Cyp4x1 UTSW 4 115112791 splice site probably benign
R1484:Cyp4x1 UTSW 4 115112901 missense probably damaging 1.00
R1675:Cyp4x1 UTSW 4 115127560 missense possibly damaging 0.94
R1718:Cyp4x1 UTSW 4 115111670 missense possibly damaging 0.75
R2208:Cyp4x1 UTSW 4 115126594 missense probably benign 0.01
R2325:Cyp4x1 UTSW 4 115124379 missense probably benign 0.40
R4223:Cyp4x1 UTSW 4 115112880 missense probably damaging 0.98
R4588:Cyp4x1 UTSW 4 115108797 missense probably damaging 1.00
R4717:Cyp4x1 UTSW 4 115121705 missense probably benign 0.02
R5522:Cyp4x1 UTSW 4 115121977 missense probably damaging 1.00
R5880:Cyp4x1 UTSW 4 115108721 missense possibly damaging 0.62
R5994:Cyp4x1 UTSW 4 115121945 missense probably benign
R6103:Cyp4x1 UTSW 4 115111667 missense probably damaging 1.00
R7733:Cyp4x1 UTSW 4 115120194 missense possibly damaging 0.50
Predicted Primers
Posted On2014-01-15