Mutagenetix > Incidental Mutations

Incidental Mutation 'R1148:Arhgef16'

102515

Institutional Source

Beutler Lab

Gene Symbol

Arhgef16

Ensembl Gene

ENSMUSG00000029032

Gene Name

Rho guanine nucleotide exchange factor (GEF) 16

Synonyms

Neuroblastoma

MMRRC Submission

039221-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1148 (G1)

Quality Score

150

Status

Validated

Chromosome

Chromosomal Location

154278486-154301676 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 154280889 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 590 (N590D)

Ref Sequence

ENSEMBL: ENSMUSP00000126296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030898] [ENSMUST00000169623]

Predicted Effect

probably benign
Transcript: ENSMUST00000030898
AA Change: N590D

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000030898
Gene: ENSMUSG00000029032
AA Change: N590D

Domain	Start	End	E-Value	Type
low complexity region	51	72	N/A	INTRINSIC
RhoGEF	292	471	5.9e-52	SMART
PH	506	626	6.46e-8	SMART
SH3	636	692	2.31e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129189

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143141

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144145

Predicted Effect

probably benign
Transcript: ENSMUST00000169623
AA Change: N590D

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000126296
Gene: ENSMUSG00000029032
AA Change: N590D

Domain	Start	End	E-Value	Type
low complexity region	51	72	N/A	INTRINSIC
RhoGEF	292	471	5.9e-52	SMART
PH	506	626	6.46e-8	SMART
SH3	636	692	2.31e-12	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 97.8%
10x: 90.3%
20x: 69.2%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Although the specific function of this protein is not known yet, it is thought to be involved in protein-protein and protein-lipid interactions. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	T	C	11: 58,876,718	S14P	probably damaging	Het
Ablim2	T	C	5: 35,809,261	F178S	probably damaging	Het
Alg10b	T	C	15: 90,227,865	F304S	possibly damaging	Het
Ank3	C	T	10: 69,882,539	S540F	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Cfap58	C	T	19: 47,988,504	H731Y	probably damaging	Het
Cilp	T	A	9: 65,280,316	L1231Q	possibly damaging	Het
Cyp4x1	A	G	4: 115,126,555		probably benign	Het
Disp2	G	A	2: 118,806,418		probably null	Het
Dnah5	T	C	15: 28,421,690	L3896P	probably damaging	Het
Dpp8	T	C	9: 65,053,832		probably null	Het
Esp4	A	C	17: 40,602,371	N43T	probably benign	Het
Fat3	T	C	9: 15,996,774	D2644G	probably damaging	Het
Fgd5	A	G	6: 91,987,631	K124E	probably benign	Het
Folh1	T	C	7: 86,761,730	D268G	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Hexdc	A	G	11: 121,221,267	I438V	probably benign	Het
Lonp2	A	G	8: 86,636,540	E262G	probably benign	Het
Ly6h	G	T	15: 75,565,172	S118R	unknown	Het
Mapk12	T	C	15: 89,134,623	Y203C	probably damaging	Het
Mapk15	A	G	15: 75,998,155	T375A	probably benign	Het
Morc2a	A	G	11: 3,678,557	N337D	probably benign	Het
Nsd3	A	G	8: 25,713,380	D1307G	probably benign	Het
Olfr1009	C	A	2: 85,722,276	Y290*	probably null	Het
Osbpl11	T	C	16: 33,227,212	F515S	probably damaging	Het
Pcdh15	T	C	10: 74,170,560	V90A	probably damaging	Het
Ptpn4	T	C	1: 119,684,540	D41G	probably damaging	Het
Ric1	T	C	19: 29,579,849	Y445H	probably benign	Het
Sez6l2	C	A	7: 126,961,812	P483Q	probably damaging	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Sfi1	CCTCTC	CCTCTCTC	11: 3,177,419		probably benign	Het
Sgo2b	A	G	8: 63,926,855	L981P	probably damaging	Het
Sh3d19	A	G	3: 86,107,327	D475G	possibly damaging	Het
Shprh	T	C	10: 11,213,482	S1655P	possibly damaging	Het
Slc25a12	G	A	2: 71,312,568		probably benign	Het
Strc	A	G	2: 121,372,077		probably benign	Het
Ttc22	G	A	4: 106,623,031	V161M	probably damaging	Het
Unc79	T	C	12: 103,112,667	L1504P	probably damaging	Het
Vldlr	A	G	19: 27,241,291	N514S	probably benign	Het

Other mutations in Arhgef16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Arhgef16	APN	4	154280244	missense	probably benign	0.01
IGL02422:Arhgef16	APN	4	154287065	nonsense	probably null
IGL02801:Arhgef16	APN	4	154291507	missense	probably damaging	0.99
IGL02928:Arhgef16	APN	4	154282893	missense	probably benign	0.00
R0518:Arhgef16	UTSW	4	154291034	missense	probably damaging	0.99
R1148:Arhgef16	UTSW	4	154280889	missense	probably benign	0.05
R1576:Arhgef16	UTSW	4	154291312	missense	probably damaging	1.00
R1778:Arhgef16	UTSW	4	154287986	missense	probably benign	0.17
R1853:Arhgef16	UTSW	4	154291106	missense	probably benign	0.14
R1912:Arhgef16	UTSW	4	154280323	splice site	probably null
R2269:Arhgef16	UTSW	4	154285033	missense	probably damaging	0.98
R4437:Arhgef16	UTSW	4	154279696	critical splice donor site	probably null
R4690:Arhgef16	UTSW	4	154287963	splice site	probably null
R5174:Arhgef16	UTSW	4	154282047	missense	probably damaging	1.00
R5566:Arhgef16	UTSW	4	154285648	missense	probably benign	0.01
R6348:Arhgef16	UTSW	4	154287083	missense	probably benign	0.18
R7264:Arhgef16	UTSW	4	154280930	missense	probably damaging	1.00
R7469:Arhgef16	UTSW	4	154291306	missense	probably damaging	1.00
R7626:Arhgef16	UTSW	4	154282882	missense	possibly damaging	0.89
R7651:Arhgef16	UTSW	4	154291067	missense	probably damaging	1.00
R7684:Arhgef16	UTSW	4	154281828	missense	possibly damaging	0.62
R7759:Arhgef16	UTSW	4	154286975	missense	probably benign	0.00
R8334:Arhgef16	UTSW	4	154282767	nonsense	probably null
Z1177:Arhgef16	UTSW	4	154281453	missense	probably damaging	1.00

Predicted Primers

Posted On

2014-01-15