Incidental Mutation 'R1148:Sez6l2'
ID102521
Institutional Source Beutler Lab
Gene Symbol Sez6l2
Ensembl Gene ENSMUSG00000030683
Gene Nameseizure related 6 homolog like 2
SynonymsPsk1
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1148 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126950563-126970606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 126961812 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 483 (P483Q)
Ref Sequence ENSEMBL: ENSMUSP00000101942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106332] [ENSMUST00000106333] [ENSMUST00000106335] [ENSMUST00000146017]
Predicted Effect probably damaging
Transcript: ENSMUST00000106332
AA Change: P423Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101939
Gene: ENSMUSG00000030683
AA Change: P423Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 70 86 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
CUB 113 226 8.25e-4 SMART
CCP 230 285 3.75e-15 SMART
CUB 289 399 1.3e-3 SMART
CCP 404 463 8.9e-8 SMART
CUB 467 578 3.45e-14 SMART
CCP 584 639 1.18e-12 SMART
CCP 645 704 1.31e-14 SMART
CCP 711 768 2.76e-13 SMART
transmembrane domain 798 820 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106333
AA Change: P483Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101940
Gene: ENSMUSG00000030683
AA Change: P483Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 115 146 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
CUB 173 286 8.25e-4 SMART
CCP 290 345 3.75e-15 SMART
CUB 349 459 1.3e-3 SMART
CCP 464 523 8.9e-8 SMART
CUB 527 638 3.45e-14 SMART
CCP 644 699 1.18e-12 SMART
CCP 705 764 1.31e-14 SMART
CCP 771 828 2.76e-13 SMART
transmembrane domain 858 880 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106335
AA Change: P483Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101942
Gene: ENSMUSG00000030683
AA Change: P483Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 115 146 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
CUB 173 286 8.25e-4 SMART
CCP 290 345 3.75e-15 SMART
CUB 349 459 1.3e-3 SMART
CCP 464 523 8.9e-8 SMART
CUB 527 638 3.45e-14 SMART
CCP 644 699 1.18e-12 SMART
CCP 705 764 1.31e-14 SMART
CCP 771 828 2.76e-13 SMART
transmembrane domain 845 867 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125669
Predicted Effect probably benign
Transcript: ENSMUST00000146017
SMART Domains Protein: ENSMUSP00000115905
Gene: ENSMUSG00000030683

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 72 91 N/A INTRINSIC
Meta Mutation Damage Score 0.1440 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seizure-related protein that is localized on the cell surface. The gene is located in a region of chromosome 16p11.2 that is thought to contain candidate genes for autism spectrum disorders (ASD), though there is no evidence directly implicating this gene in ASD. Increased expression of this gene has been found in lung cancers, and the protein is therefore considered to be a novel prognostic marker for lung cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no apparent defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in Sez6l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Sez6l2 APN 7 126961883 missense possibly damaging 0.91
IGL01710:Sez6l2 APN 7 126968216 missense probably damaging 1.00
IGL02439:Sez6l2 APN 7 126968189 missense probably damaging 0.99
IGL02752:Sez6l2 APN 7 126953733 missense probably damaging 1.00
H8786:Sez6l2 UTSW 7 126961783 missense possibly damaging 0.95
R0783:Sez6l2 UTSW 7 126967145 missense possibly damaging 0.65
R0989:Sez6l2 UTSW 7 126959844 missense probably damaging 1.00
R1148:Sez6l2 UTSW 7 126961812 missense probably damaging 1.00
R1493:Sez6l2 UTSW 7 126961812 missense probably damaging 1.00
R1509:Sez6l2 UTSW 7 126963363 missense probably damaging 1.00
R1704:Sez6l2 UTSW 7 126958341 missense probably damaging 1.00
R1817:Sez6l2 UTSW 7 126967119 missense probably damaging 1.00
R1889:Sez6l2 UTSW 7 126953496 missense probably damaging 1.00
R2509:Sez6l2 UTSW 7 126953772 missense probably benign 0.31
R3772:Sez6l2 UTSW 7 126959203 missense probably damaging 0.99
R4466:Sez6l2 UTSW 7 126959851 missense probably damaging 0.97
R4869:Sez6l2 UTSW 7 126961842 missense probably benign 0.02
R5155:Sez6l2 UTSW 7 126962373 missense probably damaging 0.99
R5416:Sez6l2 UTSW 7 126961886 missense probably damaging 1.00
R5551:Sez6l2 UTSW 7 126966830 missense probably damaging 1.00
R5884:Sez6l2 UTSW 7 126970156 unclassified probably benign
R5903:Sez6l2 UTSW 7 126970133 unclassified probably benign
R6015:Sez6l2 UTSW 7 126953453 missense probably damaging 0.97
R6726:Sez6l2 UTSW 7 126968005 missense probably damaging 0.96
R7094:Sez6l2 UTSW 7 126952924 missense probably damaging 0.99
R7117:Sez6l2 UTSW 7 126953743 missense possibly damaging 0.94
R7228:Sez6l2 UTSW 7 126953725 missense probably damaging 1.00
R7479:Sez6l2 UTSW 7 126963659 missense probably damaging 1.00
R7502:Sez6l2 UTSW 7 126961743 missense probably benign 0.26
Z1176:Sez6l2 UTSW 7 126958331 missense not run
Predicted Primers
Posted On2014-01-15