Mutagenetix > Incidental Mutations

Incidental Mutation 'R1148:Unc79'

102537

Institutional Source

Beutler Lab

Gene Symbol

Unc79

Ensembl Gene

ENSMUSG00000021198

Gene Name

unc-79 homolog (C. elegans)

Synonyms

9030205A07Rik, Mlca3

MMRRC Submission

039221-MU

Accession Numbers

Genbank: NM_001081017; MGI: 2684729; Ensembl: ENSMUST00000085079

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1148 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102948859-103184065 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103112667 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1504 (L1504P)

Ref Sequence

ENSEMBL: ENSMUSP00000136888 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085079] [ENSMUST00000101099] [ENSMUST00000178076] [ENSMUST00000179002]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085079
AA Change: L1501P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082156
Gene: ENSMUSG00000021198
AA Change: L1501P

Domain	Start	End	E-Value	Type
Pfam:UNC-79	1	469	3.1e-223	PFAM
low complexity region	732	737	N/A	INTRINSIC
low complexity region	846	862	N/A	INTRINSIC
low complexity region	968	977	N/A	INTRINSIC
low complexity region	1114	1125	N/A	INTRINSIC
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1428	1440	N/A	INTRINSIC
low complexity region	1471	1476	N/A	INTRINSIC
low complexity region	1477	1489	N/A	INTRINSIC
low complexity region	1490	1504	N/A	INTRINSIC
low complexity region	1541	1556	N/A	INTRINSIC
low complexity region	1861	1870	N/A	INTRINSIC
low complexity region	2237	2246	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101099
AA Change: L1678P

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000098659
Gene: ENSMUSG00000021198
AA Change: L1678P

Domain	Start	End	E-Value	Type
Pfam:UNC-79	113	646	1.2e-226	PFAM
low complexity region	909	914	N/A	INTRINSIC
low complexity region	1023	1039	N/A	INTRINSIC
low complexity region	1145	1154	N/A	INTRINSIC
low complexity region	1291	1302	N/A	INTRINSIC
low complexity region	1490	1502	N/A	INTRINSIC
low complexity region	1605	1617	N/A	INTRINSIC
low complexity region	1648	1653	N/A	INTRINSIC
low complexity region	1654	1666	N/A	INTRINSIC
low complexity region	1667	1681	N/A	INTRINSIC
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1999	2008	N/A	INTRINSIC
low complexity region	2375	2384	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177984

Predicted Effect

probably damaging
Transcript: ENSMUST00000178076
AA Change: L1504P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136888
Gene: ENSMUSG00000021198
AA Change: L1504P

Domain	Start	End	E-Value	Type
Pfam:UNC-79	1	450	4.2e-213	PFAM
low complexity region	713	718	N/A	INTRINSIC
low complexity region	827	843	N/A	INTRINSIC
low complexity region	949	958	N/A	INTRINSIC
low complexity region	1117	1128	N/A	INTRINSIC
low complexity region	1316	1328	N/A	INTRINSIC
low complexity region	1431	1443	N/A	INTRINSIC
low complexity region	1474	1479	N/A	INTRINSIC
low complexity region	1480	1492	N/A	INTRINSIC
low complexity region	1493	1507	N/A	INTRINSIC
low complexity region	1544	1559	N/A	INTRINSIC
low complexity region	1864	1873	N/A	INTRINSIC
low complexity region	2240	2249	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179002
AA Change: L1697P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000136332
Gene: ENSMUSG00000021198
AA Change: L1697P

Domain	Start	End	E-Value	Type
Pfam:UNC-79	60	593	1.3e-226	PFAM
low complexity region	856	861	N/A	INTRINSIC
low complexity region	970	986	N/A	INTRINSIC
low complexity region	1092	1101	N/A	INTRINSIC
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1509	1521	N/A	INTRINSIC
low complexity region	1624	1636	N/A	INTRINSIC
low complexity region	1667	1672	N/A	INTRINSIC
low complexity region	1673	1685	N/A	INTRINSIC
low complexity region	1686	1700	N/A	INTRINSIC
low complexity region	1737	1752	N/A	INTRINSIC
low complexity region	2057	2066	N/A	INTRINSIC
low complexity region	2433	2442	N/A	INTRINSIC

Meta Mutation Damage Score

0.0747

Coding Region Coverage

1x: 99.4%
3x: 97.8%
10x: 90.3%
20x: 69.2%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NALCN channel is responsible for Na(+) leak currents. The protein encoded by this gene, along with UNC80, is an accessory subunit of the NALCN channel that contributes to the Ca(2+) sensitivity of the channel. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation results in lethality within the first week after birth, mostly at P0 or P1. Pups fail to nurse and have no milk in stomachs resulting in weakness, inactivity and no weight gain. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Chemically induced(1)

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	T	C	11: 58,876,718	S14P	probably damaging	Het
Ablim2	T	C	5: 35,809,261	F178S	probably damaging	Het
Alg10b	T	C	15: 90,227,865	F304S	possibly damaging	Het
Ank3	C	T	10: 69,882,539	S540F	probably damaging	Het
Arhgef16	T	C	4: 154,280,889	N590D	probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Cfap58	C	T	19: 47,988,504	H731Y	probably damaging	Het
Cilp	T	A	9: 65,280,316	L1231Q	possibly damaging	Het
Cyp4x1	A	G	4: 115,126,555		probably benign	Het
Disp2	G	A	2: 118,806,418		probably null	Het
Dnah5	T	C	15: 28,421,690	L3896P	probably damaging	Het
Dpp8	T	C	9: 65,053,832		probably null	Het
Esp4	A	C	17: 40,602,371	N43T	probably benign	Het
Fat3	T	C	9: 15,996,774	D2644G	probably damaging	Het
Fgd5	A	G	6: 91,987,631	K124E	probably benign	Het
Folh1	T	C	7: 86,761,730	D268G	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Hexdc	A	G	11: 121,221,267	I438V	probably benign	Het
Lonp2	A	G	8: 86,636,540	E262G	probably benign	Het
Ly6h	G	T	15: 75,565,172	S118R	unknown	Het
Mapk12	T	C	15: 89,134,623	Y203C	probably damaging	Het
Mapk15	A	G	15: 75,998,155	T375A	probably benign	Het
Morc2a	A	G	11: 3,678,557	N337D	probably benign	Het
Nsd3	A	G	8: 25,713,380	D1307G	probably benign	Het
Olfr1009	C	A	2: 85,722,276	Y290*	probably null	Het
Osbpl11	T	C	16: 33,227,212	F515S	probably damaging	Het
Pcdh15	T	C	10: 74,170,560	V90A	probably damaging	Het
Ptpn4	T	C	1: 119,684,540	D41G	probably damaging	Het
Ric1	T	C	19: 29,579,849	Y445H	probably benign	Het
Sez6l2	C	A	7: 126,961,812	P483Q	probably damaging	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Sfi1	CCTCTC	CCTCTCTC	11: 3,177,419		probably benign	Het
Sgo2b	A	G	8: 63,926,855	L981P	probably damaging	Het
Sh3d19	A	G	3: 86,107,327	D475G	possibly damaging	Het
Shprh	T	C	10: 11,213,482	S1655P	possibly damaging	Het
Slc25a12	G	A	2: 71,312,568		probably benign	Het
Strc	A	G	2: 121,372,077		probably benign	Het
Ttc22	G	A	4: 106,623,031	V161M	probably damaging	Het
Vldlr	A	G	19: 27,241,291	N514S	probably benign	Het

Other mutations in Unc79

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00718:Unc79	APN	12	103169647	missense	possibly damaging	0.68
IGL00835:Unc79	APN	12	103141890	splice site	probably benign
IGL00917:Unc79	APN	12	103088507	missense	possibly damaging	0.53
IGL01012:Unc79	APN	12	103112455	missense	probably damaging	1.00
IGL01121:Unc79	APN	12	103165631	missense	probably damaging	0.99
IGL01303:Unc79	APN	12	103161867	missense	possibly damaging	0.94
IGL01305:Unc79	APN	12	103001871	missense	probably damaging	0.99
IGL01315:Unc79	APN	12	103088521	missense	possibly damaging	0.66
IGL01388:Unc79	APN	12	103169759	splice site	probably benign
IGL01415:Unc79	APN	12	103108685	missense	probably damaging	1.00
IGL01447:Unc79	APN	12	103078918	missense	probably damaging	1.00
IGL01655:Unc79	APN	12	103168287	missense	probably benign	0.00
IGL01662:Unc79	APN	12	103149020	missense	possibly damaging	0.92
IGL01728:Unc79	APN	12	103165684	missense	probably damaging	0.98
IGL01767:Unc79	APN	12	103141997	missense	probably damaging	1.00
IGL02080:Unc79	APN	12	103001975	missense	probably damaging	1.00
IGL02115:Unc79	APN	12	102998674	missense	probably damaging	1.00
IGL02176:Unc79	APN	12	102998747	splice site	probably null
IGL02186:Unc79	APN	12	103011283	missense	probably benign	0.04
IGL02205:Unc79	APN	12	103079001	missense	probably damaging	1.00
IGL02337:Unc79	APN	12	103156446	splice site	probably benign
IGL02498:Unc79	APN	12	103171578	missense	probably damaging	0.99
IGL02508:Unc79	APN	12	103112276	missense	probably damaging	0.97
IGL02508:Unc79	APN	12	103112018	splice site	probably benign
IGL02557:Unc79	APN	12	103182159	splice site	probably benign
IGL02589:Unc79	APN	12	103173496	missense	probably damaging	1.00
IGL02611:Unc79	APN	12	103165708	missense	probably damaging	0.97
IGL02728:Unc79	APN	12	103122429	missense	possibly damaging	0.53
IGL02827:Unc79	APN	12	103074846	missense	possibly damaging	0.88
IGL03028:Unc79	APN	12	103173526	missense	possibly damaging	0.83
IGL03144:Unc79	APN	12	103042142	missense	probably damaging	1.00
IGL03229:Unc79	APN	12	103134539	missense	probably damaging	0.99
IGL03269:Unc79	APN	12	103088677	missense	probably damaging	1.00
IGL03325:Unc79	APN	12	103169610	missense	probably damaging	0.98
pencil-thin	UTSW	12	103108781	splice site	probably null
sweetpea	UTSW	12	103059518	missense	probably damaging	1.00
3-1:Unc79	UTSW	12	103072750	nonsense	probably null
ANU22:Unc79	UTSW	12	103001871	missense	probably damaging	0.99
R0046:Unc79	UTSW	12	103125681	missense	probably damaging	0.99
R0046:Unc79	UTSW	12	103125681	missense	probably damaging	0.99
R0067:Unc79	UTSW	12	103059518	missense	probably damaging	1.00
R0067:Unc79	UTSW	12	103059518	missense	probably damaging	1.00
R0107:Unc79	UTSW	12	103134525	missense	possibly damaging	0.70
R0110:Unc79	UTSW	12	103079070	critical splice donor site	probably null
R0128:Unc79	UTSW	12	103088434	splice site	probably benign
R0166:Unc79	UTSW	12	103156553	missense	probably damaging	1.00
R0208:Unc79	UTSW	12	103092027	missense	probably benign	0.00
R0211:Unc79	UTSW	12	103072792	missense	probably benign	0.01
R0211:Unc79	UTSW	12	103072792	missense	probably benign	0.01
R0218:Unc79	UTSW	12	103108781	splice site	probably null
R0244:Unc79	UTSW	12	103112891	missense	probably damaging	1.00
R0305:Unc79	UTSW	12	103113200	missense	probably benign	0.18
R0310:Unc79	UTSW	12	103061407	missense	probably damaging	1.00
R0325:Unc79	UTSW	12	103171644	missense	probably damaging	0.98
R0369:Unc79	UTSW	12	103088772	critical splice donor site	probably null
R0450:Unc79	UTSW	12	103079070	critical splice donor site	probably null
R0503:Unc79	UTSW	12	103078868	missense	probably benign	0.01
R0542:Unc79	UTSW	12	103094178	splice site	probably benign
R0845:Unc79	UTSW	12	103173444	splice site	probably benign
R0893:Unc79	UTSW	12	102991428	missense	probably damaging	1.00
R1078:Unc79	UTSW	12	103074853	missense	probably benign	0.03
R1148:Unc79	UTSW	12	103112667	missense	probably damaging	1.00
R1159:Unc79	UTSW	12	103047052	splice site	probably benign
R1191:Unc79	UTSW	12	103047012	nonsense	probably null
R1307:Unc79	UTSW	12	103070076	missense	probably damaging	1.00
R1368:Unc79	UTSW	12	103156513	missense	probably damaging	1.00
R1476:Unc79	UTSW	12	103183525	missense	probably damaging	1.00
R1650:Unc79	UTSW	12	103112793	missense	possibly damaging	0.85
R1777:Unc79	UTSW	12	103112455	missense	probably damaging	1.00
R1796:Unc79	UTSW	12	103142746	missense	probably damaging	0.99
R1824:Unc79	UTSW	12	103059320	missense	probably damaging	1.00
R1830:Unc79	UTSW	12	103134478	missense	probably damaging	1.00
R1927:Unc79	UTSW	12	103169692	missense	probably damaging	1.00
R1958:Unc79	UTSW	12	102991362	missense	probably damaging	1.00
R1958:Unc79	UTSW	12	103074919	missense	probably benign	0.19
R1980:Unc79	UTSW	12	103011279	nonsense	probably null
R2019:Unc79	UTSW	12	103171571	critical splice acceptor site	probably null
R2290:Unc79	UTSW	12	103146366	missense	probably damaging	1.00
R2939:Unc79	UTSW	12	102991425	missense	probably damaging	1.00
R2962:Unc79	UTSW	12	103095119	missense	possibly damaging	0.72
R3176:Unc79	UTSW	12	103113217	missense	probably damaging	1.00
R3276:Unc79	UTSW	12	103113217	missense	probably damaging	1.00
R3683:Unc79	UTSW	12	103074803	missense	probably benign	0.00
R3684:Unc79	UTSW	12	103074803	missense	probably benign	0.00
R3686:Unc79	UTSW	12	103088661	missense	probably damaging	1.00
R3760:Unc79	UTSW	12	103092705	missense	probably damaging	1.00
R4031:Unc79	UTSW	12	103072759	missense	possibly damaging	0.46
R4039:Unc79	UTSW	12	103074949	missense	possibly damaging	0.88
R4110:Unc79	UTSW	12	103059370	missense	probably damaging	1.00
R4113:Unc79	UTSW	12	103059370	missense	probably damaging	1.00
R4159:Unc79	UTSW	12	103070253	intron	probably benign
R4273:Unc79	UTSW	12	103122353	missense	probably damaging	0.99
R4292:Unc79	UTSW	12	103183444	missense	probably damaging	0.99
R4334:Unc79	UTSW	12	103078974	missense	probably benign
R4513:Unc79	UTSW	12	103021760	missense	probably damaging	1.00
R4562:Unc79	UTSW	12	102991461	missense	probably damaging	1.00
R4576:Unc79	UTSW	12	103001803	splice site	probably benign
R4645:Unc79	UTSW	12	103112822	missense	probably benign
R4758:Unc79	UTSW	12	103161821	nonsense	probably null
R4787:Unc79	UTSW	12	103046998	missense	probably damaging	1.00
R4852:Unc79	UTSW	12	103173466	missense	probably damaging	0.98
R4883:Unc79	UTSW	12	103094333	missense	probably damaging	0.99
R4898:Unc79	UTSW	12	103161820	missense	probably damaging	0.99
R4979:Unc79	UTSW	12	103112432	missense	probably benign
R5044:Unc79	UTSW	12	103112703	missense	probably benign	0.32
R5053:Unc79	UTSW	12	103104748	missense	probably damaging	1.00
R5061:Unc79	UTSW	12	103168441	missense	possibly damaging	0.94
R5075:Unc79	UTSW	12	103074954	missense	possibly damaging	0.63
R5101:Unc79	UTSW	12	103112510	missense	probably damaging	1.00
R5236:Unc79	UTSW	12	103094395	critical splice donor site	probably null
R5240:Unc79	UTSW	12	103070751	missense	probably damaging	0.99
R5383:Unc79	UTSW	12	103104627	missense	possibly damaging	0.53
R5461:Unc79	UTSW	12	103112138	missense	probably damaging	1.00
R5535:Unc79	UTSW	12	103169703	missense	possibly damaging	0.84
R5609:Unc79	UTSW	12	103128268	missense	probably benign
R5639:Unc79	UTSW	12	103171572	missense	probably damaging	1.00
R5704:Unc79	UTSW	12	103001943	missense	probably damaging	1.00
R5923:Unc79	UTSW	12	103112468	missense	probably damaging	1.00
R5925:Unc79	UTSW	12	103125730	splice site	probably null
R5975:Unc79	UTSW	12	103125626	missense	possibly damaging	0.53
R6047:Unc79	UTSW	12	103061458	missense	probably damaging	1.00
R6156:Unc79	UTSW	12	103061458	missense	probably damaging	1.00
R6175:Unc79	UTSW	12	103183449	missense	probably damaging	0.98
R6292:Unc79	UTSW	12	103142732	missense	possibly damaging	0.88
R6313:Unc79	UTSW	12	103112619	missense	probably damaging	1.00
R6391:Unc79	UTSW	12	103021010	missense	probably damaging	1.00
R6405:Unc79	UTSW	12	103168336	missense	probably damaging	0.97
R6416:Unc79	UTSW	12	103131646	missense	possibly damaging	0.86
R6467:Unc79	UTSW	12	103173512	missense	probably damaging	1.00
R6573:Unc79	UTSW	12	103061388	missense	probably damaging	1.00
R6614:Unc79	UTSW	12	102991430	missense	probably damaging	1.00
R6654:Unc79	UTSW	12	103079048	missense	probably damaging	0.99
R6654:Unc79	UTSW	12	103079049	missense	probably damaging	1.00
R6700:Unc79	UTSW	12	103125703	missense	possibly damaging	0.92
R6724:Unc79	UTSW	12	103104861	missense	probably damaging	1.00
R6819:Unc79	UTSW	12	103142008	missense	probably benign	0.12
R6869:Unc79	UTSW	12	103113072	missense	probably benign	0.33
R6879:Unc79	UTSW	12	103148787	splice site	probably null
R6942:Unc79	UTSW	12	103122445	critical splice donor site	probably null
R6961:Unc79	UTSW	12	103112915	missense	probably damaging	1.00
R6973:Unc79	UTSW	12	102998440	missense	possibly damaging	0.86
R6980:Unc79	UTSW	12	103059500	missense	probably damaging	1.00
R7124:Unc79	UTSW	12	103061393	missense	probably damaging	0.99
R7144:Unc79	UTSW	12	103142626	missense	probably benign	0.06
R7197:Unc79	UTSW	12	103112506	missense	probably benign
R7209:Unc79	UTSW	12	103125624	missense	probably benign
R7232:Unc79	UTSW	12	103134475	missense	possibly damaging	0.49
R7304:Unc79	UTSW	12	103063190	missense	probably damaging	1.00
R7354:Unc79	UTSW	12	103142702	missense	possibly damaging	0.79
R7384:Unc79	UTSW	12	103171578	missense	probably benign	0.11
R7400:Unc79	UTSW	12	103104630	missense	probably damaging	1.00
R7417:Unc79	UTSW	12	103088758	missense	possibly damaging	0.85
R7470:Unc79	UTSW	12	103094976	missense	probably damaging	1.00
R7842:Unc79	UTSW	12	103092054	missense	probably damaging	1.00
R8037:Unc79	UTSW	12	103049919	missense	probably damaging	1.00
R8041:Unc79	UTSW	12	103088467	missense	probably benign	0.06
R8146:Unc79	UTSW	12	103070157	missense	probably damaging	0.98
R8276:Unc79	UTSW	12	103001863	missense	possibly damaging	0.94
R8427:Unc79	UTSW	12	103079038	missense	probably benign	0.24
R8501:Unc79	UTSW	12	103092638	missense	probably damaging	1.00
R8510:Unc79	UTSW	12	103104639	missense	probably damaging	1.00
R8531:Unc79	UTSW	12	103047663	missense	probably damaging	1.00
R8531:Unc79	UTSW	12	103083596	missense	probably benign	0.13
RF010:Unc79	UTSW	12	103112787	missense	probably benign	0.17
X0017:Unc79	UTSW	12	103108261	missense	probably damaging	0.99
X0028:Unc79	UTSW	12	102991403	missense	probably damaging	1.00
Z1088:Unc79	UTSW	12	103021012	missense	probably damaging	1.00
Z1176:Unc79	UTSW	12	103088678	missense	probably damaging	1.00
Z1176:Unc79	UTSW	12	103142053	missense	probably benign	0.03
Z1177:Unc79	UTSW	12	103165689	missense	probably benign

Predicted Primers

Posted On

2014-01-15