Mutagenetix > Incidental Mutations

Incidental Mutation 'R1148:Arsi'

102544

Institutional Source

Beutler Lab

Gene Symbol

Arsi

Ensembl Gene

ENSMUSG00000036412

Gene Name

arylsulfatase i

Synonyms

MMRRC Submission

039221-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R1148 (G1)

Quality Score

167

Status

Validated

Chromosome

Chromosomal Location

60911780-60918561 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 60916651 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 202 (G202E)

Ref Sequence

ENSEMBL: ENSMUSP00000043966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040359]

Predicted Effect

probably benign
Transcript: ENSMUST00000040359
AA Change: G202E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000043966
Gene: ENSMUSG00000036412
AA Change: G202E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Sulfatase	47	360	8.2e-73	PFAM
low complexity region	526	537	N/A	INTRINSIC
low complexity region	547	556	N/A	INTRINSIC

Meta Mutation Damage Score

0.0626

Coding Region Coverage

1x: 99.4%
3x: 97.8%
10x: 90.3%
20x: 69.2%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a large family of sulfatases that hydrolyze sulfate esters and sulfamates. Members of this family play a role in several cellular processes, including hormone synthesis, cell signaling in development and degradation of macromolecules. The protein encoded by this gene is thought to be secreted, and to function in extracellular space. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	T	C	11: 58,876,718	S14P	probably damaging	Het
Ablim2	T	C	5: 35,809,261	F178S	probably damaging	Het
Alg10b	T	C	15: 90,227,865	F304S	possibly damaging	Het
Ank3	C	T	10: 69,882,539	S540F	probably damaging	Het
Arhgef16	T	C	4: 154,280,889	N590D	probably benign	Het
Cfap58	C	T	19: 47,988,504	H731Y	probably damaging	Het
Cilp	T	A	9: 65,280,316	L1231Q	possibly damaging	Het
Cyp4x1	A	G	4: 115,126,555		probably benign	Het
Disp2	G	A	2: 118,806,418		probably null	Het
Dnah5	T	C	15: 28,421,690	L3896P	probably damaging	Het
Dpp8	T	C	9: 65,053,832		probably null	Het
Esp4	A	C	17: 40,602,371	N43T	probably benign	Het
Fat3	T	C	9: 15,996,774	D2644G	probably damaging	Het
Fgd5	A	G	6: 91,987,631	K124E	probably benign	Het
Folh1	T	C	7: 86,761,730	D268G	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Hexdc	A	G	11: 121,221,267	I438V	probably benign	Het
Lonp2	A	G	8: 86,636,540	E262G	probably benign	Het
Ly6h	G	T	15: 75,565,172	S118R	unknown	Het
Mapk12	T	C	15: 89,134,623	Y203C	probably damaging	Het
Mapk15	A	G	15: 75,998,155	T375A	probably benign	Het
Morc2a	A	G	11: 3,678,557	N337D	probably benign	Het
Nsd3	A	G	8: 25,713,380	D1307G	probably benign	Het
Olfr1009	C	A	2: 85,722,276	Y290*	probably null	Het
Osbpl11	T	C	16: 33,227,212	F515S	probably damaging	Het
Pcdh15	T	C	10: 74,170,560	V90A	probably damaging	Het
Ptpn4	T	C	1: 119,684,540	D41G	probably damaging	Het
Ric1	T	C	19: 29,579,849	Y445H	probably benign	Het
Sez6l2	C	A	7: 126,961,812	P483Q	probably damaging	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Sfi1	CCTCTC	CCTCTCTC	11: 3,177,419		probably benign	Het
Sgo2b	A	G	8: 63,926,855	L981P	probably damaging	Het
Sh3d19	A	G	3: 86,107,327	D475G	possibly damaging	Het
Shprh	T	C	10: 11,213,482	S1655P	possibly damaging	Het
Slc25a12	G	A	2: 71,312,568		probably benign	Het
Strc	A	G	2: 121,372,077		probably benign	Het
Ttc22	G	A	4: 106,623,031	V161M	probably damaging	Het
Unc79	T	C	12: 103,112,667	L1504P	probably damaging	Het
Vldlr	A	G	19: 27,241,291	N514S	probably benign	Het

Other mutations in Arsi

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Arsi	APN	18	60912430	missense	probably damaging	1.00
IGL02519:Arsi	APN	18	60917067	missense	probably damaging	1.00
IGL03186:Arsi	APN	18	60917473	missense	probably damaging	1.00
IGL03134:Arsi	UTSW	18	60917352	missense	probably damaging	1.00
R0003:Arsi	UTSW	18	60916986	missense	probably benign	0.29
R0003:Arsi	UTSW	18	60916986	missense	probably benign	0.29
R0448:Arsi	UTSW	18	60917302	missense	probably damaging	0.98
R1147:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1147:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1148:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1190:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1261:Arsi	UTSW	18	60916671	missense	probably damaging	1.00
R1511:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1538:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1635:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1641:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1759:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1794:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1822:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1824:Arsi	UTSW	18	60912297	missense	probably damaging	1.00
R1824:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1930:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1932:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R1983:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R2035:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R2036:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R2108:Arsi	UTSW	18	60916371	missense	possibly damaging	0.75
R2166:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R2168:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R2261:Arsi	UTSW	18	60916665	missense	probably damaging	1.00
R2263:Arsi	UTSW	18	60916665	missense	probably damaging	1.00
R2299:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R2300:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R2393:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R2402:Arsi	UTSW	18	60916467	missense	possibly damaging	0.88
R2484:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R2511:Arsi	UTSW	18	60916594	missense	probably damaging	1.00
R2994:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R2995:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R2996:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R2997:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R3625:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R3694:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R3695:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R3883:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R3884:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R3907:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R3932:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R3954:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4212:Arsi	UTSW	18	60916701	missense	probably damaging	1.00
R4256:Arsi	UTSW	18	60917316	missense	probably damaging	1.00
R4257:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4258:Arsi	UTSW	18	60917316	missense	probably damaging	1.00
R4459:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4469:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4601:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4603:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4610:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4649:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4649:Arsi	UTSW	18	60917098	missense	probably damaging	1.00
R4650:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4651:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4652:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4749:Arsi	UTSW	18	60917461	missense	probably benign	0.23
R4766:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4807:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4808:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4856:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4860:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4860:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R4886:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R5015:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R5121:Arsi	UTSW	18	60917439	missense	probably damaging	1.00
R5185:Arsi	UTSW	18	60916912	missense	probably damaging	1.00
R6191:Arsi	UTSW	18	60912472	missense	probably damaging	1.00
R6197:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R6218:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R6219:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R6220:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R6378:Arsi	UTSW	18	60916501	missense	probably damaging	1.00
R6612:Arsi	UTSW	18	60912456	missense	probably benign	0.12
R6871:Arsi	UTSW	18	60916651	missense	probably benign	0.07
R7813:Arsi	UTSW	18	60916654	missense	possibly damaging	0.58
R7974:Arsi	UTSW	18	60912406	missense	probably damaging	1.00
R8035:Arsi	UTSW	18	60916370	missense	probably damaging	1.00
Z1176:Arsi	UTSW	18	60916780	missense	probably damaging	1.00

Predicted Primers

Posted On

2014-01-15