Incidental Mutation 'R0042:Eya1'
ID102555
Institutional Source Beutler Lab
Gene Symbol Eya1
Ensembl Gene ENSMUSG00000025932
Gene NameEYA transcriptional coactivator and phosphatase 1
Synonymsbor
MMRRC Submission 038336-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R0042 (G1)
Quality Score23
Status Validated
Chromosome1
Chromosomal Location14168954-14310235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14184489 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 373 (D373G)
Ref Sequence ENSEMBL: ENSMUSP00000079493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027066] [ENSMUST00000080664] [ENSMUST00000168081] [ENSMUST00000190337]
Predicted Effect probably benign
Transcript: ENSMUST00000027066
AA Change: D406G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027066
Gene: ENSMUSG00000025932
AA Change: D406G

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000080664
AA Change: D373G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079493
Gene: ENSMUSG00000025932
AA Change: D373G

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
low complexity region 256 280 N/A INTRINSIC
PDB:3HB1|D 281 552 1e-173 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000168081
AA Change: D402G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126383
Gene: ENSMUSG00000025932
AA Change: D402G

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 207 219 N/A INTRINSIC
low complexity region 262 286 N/A INTRINSIC
PDB:3HB1|D 287 558 1e-172 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179783
Predicted Effect probably benign
Transcript: ENSMUST00000190337
AA Change: D406G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141112
Gene: ENSMUSG00000025932
AA Change: D406G

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Meta Mutation Damage Score 0.7932 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may play a role in the developing kidney, branchial arches, eye, and ear. Mutations of this gene have been associated with branchiootorenal dysplasia syndrome, branchiootic syndrome, and sporadic cases of congenital cataracts and ocular anterior segment anomalies. A similar protein in mice can act as a transcriptional activator. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mutations in this locus affect inner ear morphology and hearing, and result in dysmorphic or absent kidneys. Hypomorphs are deaf and circle. Null homozygotes additionally show agenesis of thymus and parathyroid and thyroid hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik C A 17: 25,947,982 E194* probably null Het
Abca1 C T 4: 53,059,245 probably benign Het
Acr T A 15: 89,574,332 H405Q probably benign Het
Adad1 T C 3: 37,083,173 probably benign Het
Alox5ap T C 5: 149,279,259 probably benign Het
Ank2 T C 3: 126,936,631 D3568G probably damaging Het
Atl3 T G 19: 7,529,023 I306S probably damaging Het
Atr T A 9: 95,927,356 probably benign Het
Ccnb2 A G 9: 70,419,053 V34A probably benign Het
Cdh12 A C 15: 21,537,677 probably benign Het
Cib1 C T 7: 80,230,378 V45M probably benign Het
Col6a6 T C 9: 105,780,697 E772G possibly damaging Het
Dmxl1 C A 18: 49,864,035 T466K probably benign Het
Dym T C 18: 75,125,539 probably null Het
Enpp3 A C 10: 24,774,824 F805V probably damaging Het
Gpr179 C T 11: 97,334,931 V2133I probably benign Het
Grb10 G T 11: 11,936,798 H435Q probably damaging Het
Gzmm T C 10: 79,694,565 I190T probably benign Het
Helt T C 8: 46,292,396 Y150C probably damaging Het
Hrg A T 16: 22,961,136 probably benign Het
Il17ra T C 6: 120,472,125 probably benign Het
Inhbc A G 10: 127,357,433 I238T probably benign Het
Itgb3 A G 11: 104,667,140 T787A possibly damaging Het
Jakmip2 T G 18: 43,552,145 probably benign Het
Krt4 T G 15: 101,922,752 probably benign Het
Lgsn C T 1: 31,190,453 T85I probably benign Het
Metap1 C T 3: 138,472,157 V217I probably benign Het
Mib2 A T 4: 155,659,440 C48* probably null Het
Mroh4 T A 15: 74,610,305 I768F probably damaging Het
Npas3 T A 12: 54,048,841 D361E probably damaging Het
Obscn A G 11: 59,052,585 L4246P probably damaging Het
Olfr1097 A G 2: 86,890,491 I228T probably damaging Het
Olfr1251 A C 2: 89,667,454 V144G probably benign Het
Olfr860 A G 9: 19,845,779 M280T probably benign Het
P4hb G A 11: 120,568,266 R134C probably damaging Het
Plcb3 T C 19: 6,966,420 D71G probably damaging Het
Prex2 T A 1: 11,080,081 V159E probably damaging Het
Prpsap1 T A 11: 116,479,656 K158N probably benign Het
Ptger1 G T 8: 83,668,166 V91L probably benign Het
Rdh10 T C 1: 16,108,036 probably benign Het
Rgs9bp C A 7: 35,585,033 R63L probably damaging Het
Slc13a5 A T 11: 72,259,114 V173E probably benign Het
Spata31 A T 13: 64,922,563 I842L probably benign Het
Stk32b A C 5: 37,716,748 D13E probably benign Het
Svep1 T C 4: 58,123,192 D708G possibly damaging Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Thbs1 A C 2: 118,122,877 D925A probably damaging Het
Tnr A T 1: 159,887,025 T825S probably benign Het
Ttc23l A C 15: 10,551,541 L33W probably damaging Het
Ttc39d T C 17: 80,215,950 Y13H probably benign Het
Vmn2r102 C A 17: 19,660,589 P64Q probably damaging Het
Vps11 G T 9: 44,356,291 Y341* probably null Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwce C T 19: 10,646,813 A356V probably benign Het
Other mutations in Eya1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Eya1 APN 1 14270701 splice site probably benign
IGL01110:Eya1 APN 1 14283130 missense probably damaging 1.00
IGL02266:Eya1 APN 1 14184501 missense possibly damaging 0.63
IGL03027:Eya1 APN 1 14170966 missense probably damaging 1.00
IGL03081:Eya1 APN 1 14183191 missense possibly damaging 0.76
IGL03291:Eya1 APN 1 14184348 critical splice donor site probably null
IGL03353:Eya1 APN 1 14179527 missense probably damaging 1.00
R0042:Eya1 UTSW 1 14184489 missense probably damaging 0.98
R1428:Eya1 UTSW 1 14304414 splice site probably benign
R1521:Eya1 UTSW 1 14274550 missense probably damaging 0.99
R1571:Eya1 UTSW 1 14208917 missense probably damaging 1.00
R1768:Eya1 UTSW 1 14253075 missense possibly damaging 0.95
R1785:Eya1 UTSW 1 14170974 missense probably benign 0.16
R1840:Eya1 UTSW 1 14229504 nonsense probably null
R2114:Eya1 UTSW 1 14270774 missense probably damaging 1.00
R2131:Eya1 UTSW 1 14170974 missense probably benign 0.16
R2212:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R2416:Eya1 UTSW 1 14270703 critical splice donor site probably null
R2424:Eya1 UTSW 1 14270848 splice site probably benign
R3085:Eya1 UTSW 1 14274090 missense probably benign 0.01
R3158:Eya1 UTSW 1 14304467 start gained probably benign
R3412:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R3413:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R3693:Eya1 UTSW 1 14229501 missense probably damaging 1.00
R3694:Eya1 UTSW 1 14229501 missense probably damaging 1.00
R3899:Eya1 UTSW 1 14270747 missense probably benign 0.04
R4454:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4455:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4456:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4458:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4761:Eya1 UTSW 1 14302821 missense probably damaging 1.00
R5011:Eya1 UTSW 1 14184358 missense probably damaging 1.00
R5013:Eya1 UTSW 1 14184358 missense probably damaging 1.00
R5613:Eya1 UTSW 1 14302929 intron probably benign
R5687:Eya1 UTSW 1 14183252 missense probably damaging 0.99
R6052:Eya1 UTSW 1 14283150 missense probably damaging 1.00
R6181:Eya1 UTSW 1 14302872 missense probably damaging 0.99
R6378:Eya1 UTSW 1 14302803 missense possibly damaging 0.93
R6805:Eya1 UTSW 1 14183277 missense probably benign 0.00
R6863:Eya1 UTSW 1 14270975 intron probably null
R7032:Eya1 UTSW 1 14283200 critical splice acceptor site probably null
R7044:Eya1 UTSW 1 14231410 splice site probably null
R7078:Eya1 UTSW 1 14231412 critical splice donor site probably null
R7179:Eya1 UTSW 1 14302852 missense probably damaging 1.00
R7384:Eya1 UTSW 1 14229512 missense probably damaging 1.00
R7462:Eya1 UTSW 1 14231414 missense probably null 0.99
Z1176:Eya1 UTSW 1 14302868 missense probably damaging 1.00
Z1176:Eya1 UTSW 1 14252430 missense probably benign
Z1177:Eya1 UTSW 1 14184429 missense probably damaging 0.98
Z1177:Eya1 UTSW 1 14253090 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TTATACCCAACAGTGTGGCCCCAG -3'
(R):5'- TGTTTCATCAGACGACAACGGCCAG -3'

Sequencing Primer
(F):5'- TGTGGCCCCAGAGTGAG -3'
(R):5'- AACGGCCAGGACCTGAG -3'
Posted On2014-01-15