Incidental Mutation '0152:Zfp952'
ID12
Institutional Source Beutler Lab
Gene Symbol Zfp952
Ensembl Gene ENSMUSG00000053390
Gene Namezinc finger protein 952
SynonymsC920016K16Rik
Accession Numbers

Genbank: NM_001045559; MGI: 2441928

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #0152 of strain feeble
Quality Score
Status Validated
Chromosome17
Chromosomal Location32993129-33005457 bp(+) (GRCm38)
Type of Mutationsplice site (135 bp from exon)
DNA Base Change (assembly) T to A at 33003221 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087666] [ENSMUST00000157017]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087666
AA Change: C225S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084949
Gene: ENSMUSG00000053390
AA Change: C225S

DomainStartEndE-ValueType
KRAB 10 73 4.6e-14 SMART
ZnF_C2H2 251 273 3.44e-4 SMART
ZnF_C2H2 279 301 1.28e-3 SMART
ZnF_C2H2 307 329 1.36e-2 SMART
ZnF_C2H2 335 357 2.75e-3 SMART
ZnF_C2H2 363 385 9.44e-2 SMART
ZnF_C2H2 391 413 1.47e-3 SMART
ZnF_C2H2 419 441 2.91e-2 SMART
ZnF_C2H2 447 469 2.57e-3 SMART
ZnF_C2H2 475 497 1.43e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141815
Predicted Effect probably null
Transcript: ENSMUST00000157017
SMART Domains Protein: ENSMUSP00000123066
Gene: ENSMUSG00000053390

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-17 BLAST
Meta Mutation Damage Score 0.6190 question?
Coding Region Coverage
  • 1x: 77.9%
  • 3x: 41.0%
Validation Efficiency 83% (65/78)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 6 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A T 12: 88,431,151 Q185L probably benign Het
Fscn3 A G 6: 28,429,967 probably benign Homo
Per1 T G 11: 69,104,022 probably benign Het
Pkhd1 A C 1: 20,522,894 I1665S possibly damaging Het
Tnrc6a C A 7: 123,180,654 P1303T probably damaging Het
Usp47 T C 7: 112,056,577 Y154H probably damaging Het
Other mutations in Zfp952
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Zfp952 APN 17 33002817 missense probably benign 0.00
IGL02560:Zfp952 APN 17 33002819 nonsense probably null
IGL03056:Zfp952 APN 17 33002766 missense probably damaging 0.98
IGL03151:Zfp952 APN 17 33003008 missense probably benign 0.01
R0508:Zfp952 UTSW 17 33003005 missense possibly damaging 0.90
R1936:Zfp952 UTSW 17 33003669 missense possibly damaging 0.71
R3882:Zfp952 UTSW 17 33001975 nonsense probably null
R4560:Zfp952 UTSW 17 33003954 missense probably benign 0.33
R4649:Zfp952 UTSW 17 33002925 missense probably damaging 0.99
R7103:Zfp952 UTSW 17 33003632 missense possibly damaging 0.94
R7207:Zfp952 UTSW 17 33003515 missense possibly damaging 0.93
R7209:Zfp952 UTSW 17 33003470 missense possibly damaging 0.71
R7508:Zfp952 UTSW 17 33003782 missense probably benign 0.06
R7699:Zfp952 UTSW 17 33002009 missense possibly damaging 0.53
R8424:Zfp952 UTSW 17 33003217 missense probably benign 0.18
R8445:Zfp952 UTSW 17 33003578 missense possibly damaging 0.78
Z1177:Zfp952 UTSW 17 33003104 nonsense probably null
Nature of Mutation
DNA sequencing using the SOLiD technique identified a T to A transversion at position 772 of the C920016K16Rik transcript, in exon 4 of 4 total exons for the first isoform (Figure 1). In the second isoform, the mutation occurs in exon 5 of 7 total exons. Multiple isoforms of C920016K16Rik are found on Ensembl.   
 
757 GAGGAACCATTTGTGTGTAAGCAGTATGGTGAA
220 -E--E--P--F--V--C--K--Q--Y--G--E-
 
The mutated nucleotide is indicated in red lettering, and causes a cysteine to serine substitution at amino acid 225 in the 504 amino acid isoform and amino acid 226 in the 535 amino acid isoform of the encoded protein. The mutation has been confirmed by DNA sequencing using the Sanger method (Figure 2).
Protein Function and Prediction
C920016K16Rik is an uncharacterized gene encoding a hypothetical protein product of 504 amino acids, which has general homology to zinc-finger binding proteins and contains nine predicted C2H2 zinc fingers in amino acids 251-497 (SMARTprogram). The predicted polypeptide also contains a KRAB domain (or Kruppel-associated box) at amino acids 10-73. The KRAB domain is present in about a third of zinc finger proteins containing C2H2 fingers, and is involved in protein-protein interactions. The KRAB domain is generally encoded by two exons with the regions coded by the two exons known as KRAB-A and KRAB-B.  The A box plays an important role in repression by binding to corepressors, while the B box is thought to enhance repression by the A box (1). In the predicted protein encoded by C920016K16Rik, these regions are encoded by exons 2 and 3.  KRAB-containing proteins are thought to have critical functions in cell proliferation and differentiation, apoptosis and neoplastic transformation (1).
 
C920016K16Rik is predicted to have another isoform produced by alternative splicing. This isoform is 535 amino acids long. 
 
The C225S alteration does not occur in any known domains, but is predicted to be probably damaging by the PolyPhen program.
References

1. Urrutia, R. (2003) KRAB-Containing Zinc-Finger Repressor Proteins. Genome Biol. 4, 231.

Posted On2009-11-03