Incidental Mutation 'R0083:Col22a1'
ID150634
Institutional Source Beutler Lab
Gene Symbol Col22a1
Ensembl Gene ENSMUSG00000079022
Gene Namecollagen, type XXII, alpha 1
SynonymsC80743, 2310067L16Rik
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0083 (G1)
Quality Score30
Status Validated
Chromosome15
Chromosomal Location71795795-72034227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71890497 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 104 (D104E)
Ref Sequence ENSEMBL: ENSMUSP00000124270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159993] [ENSMUST00000160513] [ENSMUST00000229585]
Predicted Effect unknown
Transcript: ENSMUST00000159993
AA Change: D993E
SMART Domains Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: D993E

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
VWA 45 227 1.35e-51 SMART
TSPN 248 436 1.26e-33 SMART
low complexity region 454 470 N/A INTRINSIC
internal_repeat_3 494 555 1.96e-13 PROSPERO
internal_repeat_1 496 643 1.49e-19 PROSPERO
low complexity region 644 657 N/A INTRINSIC
low complexity region 673 707 N/A INTRINSIC
Pfam:Collagen 751 823 1.5e-9 PFAM
Pfam:Collagen 810 863 2.3e-10 PFAM
Pfam:Collagen 869 931 4.8e-11 PFAM
Pfam:Collagen 926 990 1.1e-10 PFAM
Pfam:Collagen 1031 1087 1.7e-10 PFAM
Pfam:Collagen 1104 1162 1.8e-11 PFAM
low complexity region 1173 1227 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
internal_repeat_2 1257 1348 3.25e-18 PROSPERO
internal_repeat_4 1268 1347 9.67e-7 PROSPERO
Pfam:Collagen 1389 1448 4e-10 PFAM
Pfam:Collagen 1481 1540 2.6e-9 PFAM
low complexity region 1546 1558 N/A INTRINSIC
low complexity region 1580 1590 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160513
AA Change: D104E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124270
Gene: ENSMUSG00000079022
AA Change: D104E

DomainStartEndE-ValueType
Pfam:Collagen 1 60 5.7e-13 PFAM
Pfam:Collagen 43 102 1.3e-12 PFAM
Pfam:Collagen 100 143 2.2e-8 PFAM
Pfam:Collagen 142 194 1.9e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000229585
AA Change: D438E
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Col22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Col22a1 APN 15 71860958 critical splice donor site probably null
IGL00434:Col22a1 APN 15 72006675 missense possibly damaging 0.71
IGL00721:Col22a1 APN 15 71846177 missense unknown
IGL00902:Col22a1 APN 15 71964659 missense probably damaging 1.00
IGL01311:Col22a1 APN 15 71973637 splice site probably benign
IGL01329:Col22a1 APN 15 71907040 missense probably benign 0.02
IGL01527:Col22a1 APN 15 71907031 missense probably damaging 0.98
IGL01870:Col22a1 APN 15 71952528 missense probably benign 0.07
IGL02002:Col22a1 APN 15 71811097 splice site probably benign
IGL02248:Col22a1 APN 15 71799448 missense unknown
IGL02322:Col22a1 APN 15 71822653 missense unknown
IGL02472:Col22a1 APN 15 71827753 splice site probably benign
IGL02685:Col22a1 APN 15 71801915 missense unknown
IGL02888:Col22a1 APN 15 71846219 missense unknown
IGL02971:Col22a1 APN 15 72006738 missense probably damaging 1.00
IGL03175:Col22a1 APN 15 71969103 missense possibly damaging 0.81
IGL03240:Col22a1 APN 15 71807928 missense unknown
R0383:Col22a1 UTSW 15 71869004 missense unknown
R0449:Col22a1 UTSW 15 71962671 critical splice donor site probably null
R0508:Col22a1 UTSW 15 71933413 missense unknown
R0944:Col22a1 UTSW 15 71881662 missense probably benign 0.03
R1289:Col22a1 UTSW 15 71837377 missense unknown
R1436:Col22a1 UTSW 15 71922957 splice site probably benign
R1439:Col22a1 UTSW 15 71952377 splice site probably benign
R1460:Col22a1 UTSW 15 71821931 missense unknown
R1680:Col22a1 UTSW 15 71799361 missense unknown
R1715:Col22a1 UTSW 15 72006981 missense possibly damaging 0.79
R1742:Col22a1 UTSW 15 71801913 missense unknown
R1745:Col22a1 UTSW 15 72006787 missense probably damaging 1.00
R1763:Col22a1 UTSW 15 72007176 missense probably damaging 0.96
R1932:Col22a1 UTSW 15 71870140 missense unknown
R2125:Col22a1 UTSW 15 71848577 missense unknown
R2126:Col22a1 UTSW 15 71857253 nonsense probably null
R2137:Col22a1 UTSW 15 72006948 missense possibly damaging 0.46
R2860:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2861:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2862:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R3704:Col22a1 UTSW 15 71970307 missense probably damaging 1.00
R3778:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
R3940:Col22a1 UTSW 15 71981933 nonsense probably null
R3950:Col22a1 UTSW 15 71977358 missense possibly damaging 0.90
R4240:Col22a1 UTSW 15 72007131 missense probably damaging 1.00
R4531:Col22a1 UTSW 15 72007149 missense probably damaging 1.00
R4597:Col22a1 UTSW 15 71964662 missense possibly damaging 0.83
R4604:Col22a1 UTSW 15 71952339 missense probably benign 0.36
R4654:Col22a1 UTSW 15 71973695 missense possibly damaging 0.95
R4782:Col22a1 UTSW 15 71801925 missense unknown
R4847:Col22a1 UTSW 15 71799499 missense unknown
R4980:Col22a1 UTSW 15 71801943 missense unknown
R4981:Col22a1 UTSW 15 71861066 missense unknown
R4996:Col22a1 UTSW 15 72007161 missense probably damaging 0.99
R5007:Col22a1 UTSW 15 71944422 missense probably damaging 1.00
R5135:Col22a1 UTSW 15 71799337 missense unknown
R5197:Col22a1 UTSW 15 72009406 missense probably damaging 0.96
R5292:Col22a1 UTSW 15 71970336 missense probably damaging 1.00
R5449:Col22a1 UTSW 15 71821949 missense unknown
R5480:Col22a1 UTSW 15 71964611 missense probably damaging 0.98
R5627:Col22a1 UTSW 15 71981918 missense probably damaging 0.98
R5828:Col22a1 UTSW 15 72009491 missense probably benign 0.01
R5927:Col22a1 UTSW 15 72006966 missense probably damaging 1.00
R6006:Col22a1 UTSW 15 71973836 missense probably damaging 1.00
R6245:Col22a1 UTSW 15 71973816 missense probably damaging 0.99
R6288:Col22a1 UTSW 15 71894869 critical splice acceptor site probably null
R6482:Col22a1 UTSW 15 71890489 missense possibly damaging 0.93
R6497:Col22a1 UTSW 15 71890576 missense possibly damaging 0.85
R6579:Col22a1 UTSW 15 71881653 missense probably benign 0.18
R6643:Col22a1 UTSW 15 71822037 intron probably null
R6663:Col22a1 UTSW 15 71820059 missense unknown
R7179:Col22a1 UTSW 15 71933413 missense unknown
R7215:Col22a1 UTSW 15 71970332 nonsense probably null
R7216:Col22a1 UTSW 15 71973845 missense probably damaging 1.00
R7505:Col22a1 UTSW 15 71799399 nonsense probably null
X0066:Col22a1 UTSW 15 71801879 missense unknown
X0066:Col22a1 UTSW 15 71846200 missense unknown
Y5406:Col22a1 UTSW 15 71799515 missense unknown
Predicted Primers PCR Primer
(F):5'- TAAGCACGCTGATTGACGACAGGAC -3'
(R):5'- ACTTCAGCATGTGAATGTGGGGAAC -3'

Sequencing Primer
(F):5'- GATTGACGACAGGACTATGTCCC -3'
(R):5'- GGAACAGAGTTCAACTTCTCACTTC -3'
Posted On2014-01-23