Incidental Mutation 'R0009:Dusp8'
ID150643
Institutional Source Beutler Lab
Gene Symbol Dusp8
Ensembl Gene ENSMUSG00000037887
Gene Namedual specificity phosphatase 8
Synonyms5530400B01Rik, Nttp1
MMRRC Submission 038304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R0009 (G1)
Quality Score42
Status Validated
Chromosome7
Chromosomal Location142079490-142095843 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 142082054 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039926] [ENSMUST00000143661]
Predicted Effect unknown
Transcript: ENSMUST00000039926
AA Change: S600G
SMART Domains Protein: ENSMUSP00000049414
Gene: ENSMUSG00000037887
AA Change: S600G

DomainStartEndE-ValueType
RHOD 13 135 4.71e-14 SMART
DSPc 160 299 3.6e-69 SMART
low complexity region 334 353 N/A INTRINSIC
low complexity region 360 371 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
low complexity region 488 512 N/A INTRINSIC
low complexity region 546 600 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104221
Predicted Effect probably benign
Transcript: ENSMUST00000143661
SMART Domains Protein: ENSMUSP00000114307
Gene: ENSMUSG00000037887

DomainStartEndE-ValueType
RHOD 13 135 4.71e-14 SMART
Pfam:DSPc 168 231 1.5e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates SAPK/JNK and p38, is expressed predominantly in the adult brain, heart, and skeletal muscle, is localized in the cytoplasm, and is induced by nerve growth factor and insulin. An intronless pseudogene for DUSP8 is present on chromosome 10q11.2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered myocardial fiber morphology, mildly increased cardiac muscle contractility at baseline, and decreased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,919,633 probably benign Het
Abcg4 T G 9: 44,277,649 probably benign Het
Afm C A 5: 90,545,384 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Aplnr T A 2: 85,137,276 probably null Het
Arih2 T A 9: 108,611,727 H264L probably damaging Het
Atp1a1 A T 3: 101,579,835 I886N possibly damaging Het
Bmf A T 2: 118,549,622 V14E probably damaging Het
Ccdc116 T C 16: 17,144,039 E15G probably damaging Het
Ccdc175 T C 12: 72,135,965 N427D possibly damaging Het
Cfap53 A G 18: 74,299,176 H45R probably benign Het
Chd3 A G 11: 69,349,906 L1569P probably damaging Het
Cntn2 G A 1: 132,516,180 Q457* probably null Het
Coro1a A T 7: 126,701,413 probably benign Het
Cracr2b T A 7: 141,463,759 L91Q probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dip2b T A 15: 100,169,312 L565Q probably damaging Het
Dip2c T A 13: 9,621,903 C1004S probably damaging Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah14 A G 1: 181,769,407 probably benign Het
Dnase1 T C 16: 4,038,946 V147A probably damaging Het
Fer1l6 T C 15: 58,662,787 Y1828H probably damaging Het
Flvcr1 A G 1: 191,008,191 V544A probably benign Het
Fsd1l T C 4: 53,687,209 V311A probably benign Het
Glud1 G A 14: 34,334,268 G300S probably benign Het
Gm4847 C T 1: 166,630,486 V433I probably benign Het
Gstm3 T G 3: 107,967,840 Y62S probably damaging Het
Gtse1 C T 15: 85,862,435 P151S probably benign Het
Herc2 T C 7: 56,207,812 S4048P probably benign Het
Hp1bp3 T A 4: 138,221,683 I19K probably benign Het
Htr7 C A 19: 36,041,540 probably benign Het
Il1a C T 2: 129,309,074 D10N probably damaging Het
Il22ra2 A T 10: 19,624,458 N39I probably damaging Het
Kcnn4 T C 7: 24,379,255 C267R possibly damaging Het
Larp1 A G 11: 58,055,473 K879R possibly damaging Het
Lcn5 T A 2: 25,661,405 probably benign Het
Lep T A 6: 29,068,972 C7* probably null Het
Magi2 A T 5: 20,611,055 Y747F probably benign Het
Mast4 T C 13: 102,742,058 T1223A probably damaging Het
Mcc C T 18: 44,445,933 E803K probably damaging Het
Mtmr4 T C 11: 87,611,508 I796T probably benign Het
Myef2 A T 2: 125,108,978 D312E probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo19 T A 11: 84,888,169 probably null Het
Naa15 T G 3: 51,470,219 H763Q probably damaging Het
Pde5a C T 3: 122,824,902 probably benign Het
Plpp2 C T 10: 79,527,244 R184H probably benign Het
Rab19 T G 6: 39,389,687 L179V probably damaging Het
Rims2 T A 15: 39,534,966 M1087K probably damaging Het
Riox2 C A 16: 59,489,367 D361E probably benign Het
Sh3rf1 T A 8: 61,226,293 V123E probably damaging Het
Slc35e1 A T 8: 72,484,709 N318K probably damaging Het
Slc9a2 A T 1: 40,763,602 E604V probably benign Het
Srp72 T C 5: 76,987,885 S221P probably damaging Het
Tbx19 A T 1: 165,160,520 S15T possibly damaging Het
Tcea2 A G 2: 181,685,817 T112A probably benign Het
Tesk1 T A 4: 43,445,368 D230E probably damaging Het
Tm4sf5 C T 11: 70,510,712 A179V probably damaging Het
Tnr G T 1: 159,852,416 G320V probably damaging Het
Trappc11 A T 8: 47,503,320 C874S possibly damaging Het
Trpm3 T A 19: 22,914,446 Y885N probably damaging Het
Unc5a T A 13: 55,002,879 C505S probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Xpo5 T C 17: 46,204,786 probably benign Het
Zfp637 C A 6: 117,845,668 H252Q probably damaging Het
Zfp646 T A 7: 127,880,731 D693E probably damaging Het
Other mutations in Dusp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Dusp8 APN 7 142084423 missense probably benign 0.05
IGL02458:Dusp8 APN 7 142082747 missense probably benign 0.28
IGL02931:Dusp8 APN 7 142082930 missense probably benign 0.00
IGL03329:Dusp8 APN 7 142084360 nonsense probably null
R1054:Dusp8 UTSW 7 142082067 unclassified probably benign
R1611:Dusp8 UTSW 7 142082957 missense probably benign 0.04
R1883:Dusp8 UTSW 7 142084348 splice site probably null
R2119:Dusp8 UTSW 7 142082561 missense possibly damaging 0.91
R2326:Dusp8 UTSW 7 142090063 missense probably damaging 1.00
R2698:Dusp8 UTSW 7 142081964 unclassified probably benign
R2905:Dusp8 UTSW 7 142083389 nonsense probably null
R3849:Dusp8 UTSW 7 142090065 missense probably damaging 1.00
R4921:Dusp8 UTSW 7 142082154 unclassified probably benign
R4942:Dusp8 UTSW 7 142082228 missense possibly damaging 0.85
R5288:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R5385:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R5386:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R6301:Dusp8 UTSW 7 142083019 splice site probably null
R6520:Dusp8 UTSW 7 142083681 missense probably damaging 0.99
R6665:Dusp8 UTSW 7 142090105 missense probably damaging 0.97
RF016:Dusp8 UTSW 7 142082852 missense probably benign 0.04
X0064:Dusp8 UTSW 7 142082027 unclassified probably benign
Z1176:Dusp8 UTSW 7 142081943 missense unknown
Z1176:Dusp8 UTSW 7 142090077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACGATACTTCGATGACCTCCAC -3'
(R):5'- ACATCAAGTCGGCCTATGCACC -3'

Sequencing Primer
(F):5'- TCCACGCTGCCAGAGAAG -3'
(R):5'- GGCCTGAACTTTGGAGACAC -3'
Posted On2014-01-27