Incidental Mutation 'R1286:Aif1'
ID 150653
Institutional Source Beutler Lab
Gene Symbol Aif1
Ensembl Gene ENSMUSG00000024397
Gene Name allograft inflammatory factor 1
Synonyms G1, D17H6S50E, Iba1
MMRRC Submission 039352-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R1286 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 35389967-35394977 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 35391127 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 44 (P44L)
Ref Sequence ENSEMBL: ENSMUSP00000134107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025257] [ENSMUST00000172693] [ENSMUST00000173106] [ENSMUST00000173324]
AlphaFold O70200
Predicted Effect probably benign
Transcript: ENSMUST00000025257
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025257
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172679
Predicted Effect probably benign
Transcript: ENSMUST00000172693
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134214
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173106
AA Change: P44L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134107
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 128 4e-47 PDB
Blast:EFh 98 122 4e-9 BLAST
SCOP:d1mr8a_ 98 128 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173281
Predicted Effect probably benign
Transcript: ENSMUST00000173324
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133709
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174044
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased spleen weight, decreased platalet cell number and decreased susceptibility to induced arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 5 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cimip2c G A 5: 30,637,851 (GRCm39) G66E probably damaging Het
F5 G C 1: 164,026,486 (GRCm39) R1686P probably damaging Het
Gm17535 T A 9: 3,035,786 (GRCm39) L218H probably benign Het
Hlx G T 1: 184,464,184 (GRCm39) A52D probably damaging Het
Spopfm1 A G 3: 94,173,102 (GRCm39) M37V probably benign Het
Other mutations in Aif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Aif1 APN 17 35,390,531 (GRCm39) missense probably damaging 1.00
IGL03279:Aif1 APN 17 35,390,523 (GRCm39) nonsense probably null
N/A:Aif1 UTSW 17 35,391,496 (GRCm39) missense possibly damaging 0.83
R0396:Aif1 UTSW 17 35,390,085 (GRCm39) makesense probably null
R1062:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R1063:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R1064:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R1105:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R1122:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R1154:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R1447:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R1678:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R1689:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R1750:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R1911:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R1974:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R2314:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R2338:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R2341:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R2915:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
R4953:Aif1 UTSW 17 35,390,074 (GRCm39) splice site probably null
R5260:Aif1 UTSW 17 35,390,917 (GRCm39) critical splice acceptor site probably null
R6786:Aif1 UTSW 17 35,390,472 (GRCm39) missense probably damaging 1.00
R7503:Aif1 UTSW 17 35,390,549 (GRCm39) missense probably damaging 1.00
R7534:Aif1 UTSW 17 35,390,390 (GRCm39) missense possibly damaging 0.77
R7891:Aif1 UTSW 17 35,391,600 (GRCm39) start gained probably benign
R8075:Aif1 UTSW 17 35,390,811 (GRCm39) missense unknown
Y4338:Aif1 UTSW 17 35,391,127 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCGCCGCCCATGTATTATTGGTTG -3'
(R):5'- TCTGTACCCCTCAGGAGGAAAAGC -3'

Sequencing Primer
(F):5'- CCATGTACTTCACTGGACGAG -3'
(R):5'- TTTGGACTGCTGAAGGCCC -3'
Posted On 2014-01-29