Mutagenetix > Incidental Mutation

Incidental Mutation 'R1285:Atf2'

150655

Institutional Source

Beutler Lab

Gene Symbol

Atf2

Ensembl Gene

ENSMUSG00000027104

Gene Name

activating transcription factor 2

Synonyms

mXBP, ATF-2, CRE-BP, D130078H02Rik, Creb2

MMRRC Submission

039351-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.935) question?

Stock #

R1285 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73646853-73722983 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 73675853 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 123 (G123E)

Ref Sequence

ENSEMBL: ENSMUSP00000118719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055833] [ENSMUST00000090802] [ENSMUST00000100009] [ENSMUST00000112007] [ENSMUST00000112010] [ENSMUST00000112016] [ENSMUST00000112017] [ENSMUST00000128531] [ENSMUST00000154456] [ENSMUST00000173010] [ENSMUST00000136958]

AlphaFold

P16951

Predicted Effect

probably damaging
Transcript: ENSMUST00000055833
AA Change: G206E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058521
Gene: ENSMUSG00000027104
AA Change: G206E

Domain	Start	End	E-Value	Type
ZnF_C2H2	7	31	4.4e-2	SMART
low complexity region	237	254	N/A	INTRINSIC
low complexity region	300	316	N/A	INTRINSIC
BRLZ	332	396	3.15e-21	SMART
low complexity region	437	449	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000090802
AA Change: G166E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088311
Gene: ENSMUSG00000027104
AA Change: G166E

Domain	Start	End	E-Value	Type
low complexity region	197	214	N/A	INTRINSIC
low complexity region	260	276	N/A	INTRINSIC
BRLZ	292	356	3.15e-21	SMART
low complexity region	397	409	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100009
AA Change: G206E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097588
Gene: ENSMUSG00000027104
AA Change: G206E

Domain	Start	End	E-Value	Type
ZnF_C2H2	7	31	4.4e-2	SMART
low complexity region	237	254	N/A	INTRINSIC
low complexity region	300	316	N/A	INTRINSIC
BRLZ	332	396	3.15e-21	SMART
low complexity region	437	449	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112007
AA Change: G166E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107638
Gene: ENSMUSG00000027104
AA Change: G166E

Domain	Start	End	E-Value	Type
low complexity region	197	214	N/A	INTRINSIC
low complexity region	260	276	N/A	INTRINSIC
BRLZ	292	356	3.15e-21	SMART
low complexity region	397	409	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112010
AA Change: G166E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107641
Gene: ENSMUSG00000027104
AA Change: G166E

Domain	Start	End	E-Value	Type
low complexity region	197	214	N/A	INTRINSIC
low complexity region	260	276	N/A	INTRINSIC
BRLZ	292	356	3.15e-21	SMART
low complexity region	397	409	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112016

SMART Domains

Protein: ENSMUSP00000107647
Gene: ENSMUSG00000027104

Domain	Start	End	E-Value	Type
ZnF_C2H2	7	31	4.4e-2	SMART
low complexity region	139	156	N/A	INTRINSIC
low complexity region	202	218	N/A	INTRINSIC
BRLZ	234	298	3.15e-21	SMART
low complexity region	339	351	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112017
AA Change: G206E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107648
Gene: ENSMUSG00000027104
AA Change: G206E

Domain	Start	End	E-Value	Type
ZnF_C2H2	7	31	4.4e-2	SMART
low complexity region	237	254	N/A	INTRINSIC
low complexity region	300	316	N/A	INTRINSIC
BRLZ	332	396	3.15e-21	SMART
low complexity region	437	449	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143714

Predicted Effect

possibly damaging
Transcript: ENSMUST00000128531
AA Change: G206E

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000118560
Gene: ENSMUSG00000027104
AA Change: G206E

Domain	Start	End	E-Value	Type
ZnF_C2H2	7	31	4.4e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000154456
AA Change: G123E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000173010
AA Change: G206E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000133632
Gene: ENSMUSG00000027104
AA Change: G206E

Domain	Start	End	E-Value	Type
ZnF_C2H2	7	31	4.4e-2	SMART
low complexity region	237	254	N/A	INTRINSIC
low complexity region	300	316	N/A	INTRINSIC
BRLZ	332	377	1.32e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129555

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141050

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156455

Predicted Effect

probably benign
Transcript: ENSMUST00000136958

SMART Domains

Protein: ENSMUSP00000118357
Gene: ENSMUSG00000027104

Domain	Start	End	E-Value	Type
ZnF_C2H2	7	31	4.4e-2	SMART
low complexity region	139	156	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124737

SMART Domains

Protein: ENSMUSP00000114828
Gene: ENSMUSG00000027104

Domain	Start	End	E-Value	Type
low complexity region	31	48	N/A	INTRINSIC
low complexity region	94	110	N/A	INTRINSIC
BRLZ	126	190	3.89e-12	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions This protein binds to the cAMP-responsive element (CRE), an octameric palindrome. It forms a homodimer or a heterodimer with c-Jun and stimulates CRE-dependent transcription. This protein is also a histone acetyltransferase (HAT) that specifically acetylates histones H2B and H4 in vitro; thus it may represent a class of sequence-specific factors that activate transcription by direct effects on chromatin components. The encoded protein may also be involved in cell's DNA damage response independent of its role in transcriptional regulation. Several alternatively spliced transcript variants have been found for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutation of this gene results in increased postnatal lethality, skeletal development defects, runting, decreased hearing, inner ear and brain abnormalities, hyperactivity, and ataxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 3 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	GCC	GC	13: 59,839,412 (GRCm39)		probably null	Het
Cimip2c	G	A	5: 30,637,851 (GRCm39)	G66E	probably damaging	Het
Hlx	G	T	1: 184,464,184 (GRCm39)	A52D	probably damaging	Het

Other mutations in Atf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00886:Atf2	APN	2	73,675,847 (GRCm39)	missense	possibly damaging	0.85
IGL01608:Atf2	APN	2	73,649,422 (GRCm39)	missense	probably damaging	1.00
IGL02112:Atf2	APN	2	73,649,381 (GRCm39)	missense	probably damaging	1.00
IGL02469:Atf2	APN	2	73,676,676 (GRCm39)	missense	probably damaging	0.99
IGL02686:Atf2	APN	2	73,675,844 (GRCm39)	missense	possibly damaging	0.90
IGL03381:Atf2	APN	2	73,659,012 (GRCm39)	missense	probably benign	0.13
R0020:Atf2	UTSW	2	73,676,628 (GRCm39)	missense	possibly damaging	0.81
R0020:Atf2	UTSW	2	73,676,628 (GRCm39)	missense	possibly damaging	0.81
R0045:Atf2	UTSW	2	73,660,200 (GRCm39)	missense	probably benign	0.02
R0045:Atf2	UTSW	2	73,660,200 (GRCm39)	missense	probably benign	0.02
R0480:Atf2	UTSW	2	73,649,500 (GRCm39)	splice site	probably benign
R0732:Atf2	UTSW	2	73,675,844 (GRCm39)	missense	possibly damaging	0.90
R1188:Atf2	UTSW	2	73,675,881 (GRCm39)	missense	probably damaging	0.96
R1287:Atf2	UTSW	2	73,675,853 (GRCm39)	missense	probably damaging	1.00
R1523:Atf2	UTSW	2	73,693,552 (GRCm39)	missense	probably damaging	1.00
R1622:Atf2	UTSW	2	73,684,133 (GRCm39)	splice site	probably null
R1731:Atf2	UTSW	2	73,675,853 (GRCm39)	missense	probably damaging	1.00
R1935:Atf2	UTSW	2	73,676,563 (GRCm39)	missense	probably damaging	1.00
R1939:Atf2	UTSW	2	73,676,563 (GRCm39)	missense	probably damaging	1.00
R1965:Atf2	UTSW	2	73,681,242 (GRCm39)	missense	possibly damaging	0.87
R2000:Atf2	UTSW	2	73,693,584 (GRCm39)	critical splice acceptor site	probably null
R2045:Atf2	UTSW	2	73,693,552 (GRCm39)	missense	probably damaging	1.00
R2256:Atf2	UTSW	2	73,675,855 (GRCm39)	splice site	probably null
R3147:Atf2	UTSW	2	73,681,283 (GRCm39)	splice site	probably null
R3890:Atf2	UTSW	2	73,693,557 (GRCm39)	missense	probably damaging	1.00
R4680:Atf2	UTSW	2	73,659,025 (GRCm39)	splice site	probably null
R4715:Atf2	UTSW	2	73,653,644 (GRCm39)	missense	probably damaging	1.00
R5161:Atf2	UTSW	2	73,660,134 (GRCm39)	critical splice donor site	probably null
R5853:Atf2	UTSW	2	73,658,813 (GRCm39)	splice site	probably null
R7419:Atf2	UTSW	2	73,672,777 (GRCm39)	missense	probably benign	0.01
R7833:Atf2	UTSW	2	73,684,229 (GRCm39)	missense	possibly damaging	0.94
R9202:Atf2	UTSW	2	73,649,472 (GRCm39)	missense	probably damaging	0.99
R9266:Atf2	UTSW	2	73,649,271 (GRCm39)	missense	probably benign	0.27
R9690:Atf2	UTSW	2	73,675,813 (GRCm39)	missense	probably benign	0.26
X0033:Atf2	UTSW	2	73,676,625 (GRCm39)	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- ACCTAGTCAAACTGGAGTGAGGTGAAT -3'
(R):5'- AGTAACTCCCAAGACCTTTCTGATGAGA -3'

Sequencing Primer
(F):5'- GGTTTCAATCCAATTATGTTTGCC -3'
(R):5'- GGAAATCCATGATTTTTCCCCAGG -3'

Posted On

2014-01-29