Incidental Mutation 'R1288:Msl2'
ID150674
Institutional Source Beutler Lab
Gene Symbol Msl2
Ensembl Gene ENSMUSG00000066415
Gene NameMSL complex subunit 2
SynonymsMsl2l1, Rnf184
MMRRC Submission 039354-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1288 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location101074101-101104800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101102109 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 561 (T561A)
Ref Sequence ENSEMBL: ENSMUSP00000082270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066773] [ENSMUST00000075941] [ENSMUST00000085177] [ENSMUST00000189616]
Predicted Effect probably benign
Transcript: ENSMUST00000066773
SMART Domains Protein: ENSMUSP00000069688
Gene: ENSMUSG00000043154

DomainStartEndE-ValueType
Blast:EFh 140 169 1e-9 BLAST
Pfam:EF-hand_7 282 380 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075941
SMART Domains Protein: ENSMUSP00000075327
Gene: ENSMUSG00000043154

DomainStartEndE-ValueType
low complexity region 248 266 N/A INTRINSIC
Blast:EFh 760 789 1e-9 BLAST
Pfam:EF-hand_7 902 1000 2.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085177
AA Change: T561A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000082270
Gene: ENSMUSG00000066415
AA Change: T561A

DomainStartEndE-ValueType
Pfam:zf-RING_10 42 111 2.8e-36 PFAM
low complexity region 265 281 N/A INTRINSIC
low complexity region 340 351 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
CXC 457 504 1.6e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189616
SMART Domains Protein: ENSMUSP00000139396
Gene: ENSMUSG00000066415

DomainStartEndE-ValueType
PDB:4B86|L 1 47 2e-28 PDB
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A T 5: 129,129,007 D247V probably damaging Het
Ano5 A T 7: 51,546,872 S184C probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Atxn3 C T 12: 101,942,178 probably null Het
BC005537 A T 13: 24,804,900 E54V probably damaging Het
Ccdc150 A T 1: 54,364,458 E881V probably damaging Het
Cep126 A T 9: 8,112,181 N130K probably benign Het
Enoph1 A G 5: 100,040,279 T21A possibly damaging Het
Fbxw28 A G 9: 109,337,293 I165T probably damaging Het
Lrp12 A T 15: 39,878,403 N305K probably damaging Het
Mup21 G T 4: 62,150,697 A19E probably benign Het
Myh13 T C 11: 67,353,718 I1027T probably benign Het
Nkg7 A G 7: 43,437,662 probably null Het
Nme8 A G 13: 19,674,449 V73A possibly damaging Het
Olfr1135 G A 2: 87,671,572 A265V probably benign Het
Olfr123 T A 17: 37,795,693 L83Q probably damaging Het
Olfr138 A G 17: 38,275,223 T151A probably benign Het
Olfr68 A T 7: 103,778,042 L101Q possibly damaging Het
Olfr822 A G 10: 130,075,285 N292D probably damaging Het
Rapgef3 C A 15: 97,759,342 S267I probably benign Het
Trhde T A 10: 114,801,290 D4V probably benign Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp40 T A 17: 23,182,162 I36L probably benign Het
Other mutations in Msl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Msl2 APN 9 101101070 missense probably benign 0.13
IGL02496:Msl2 APN 9 101100655 missense possibly damaging 0.93
IGL02798:Msl2 APN 9 101075377 missense probably benign 0.06
IGL03235:Msl2 APN 9 101100768 missense probably benign 0.03
anguished UTSW 9 101101975 missense possibly damaging 0.66
Appalled UTSW 9 101100843 missense probably benign
Crestfallen UTSW 9 101101091 nonsense probably null
R0497:Msl2 UTSW 9 101101294 missense probably benign 0.00
R2015:Msl2 UTSW 9 101075251 start gained probably benign
R2038:Msl2 UTSW 9 101101984 missense probably damaging 1.00
R2238:Msl2 UTSW 9 101101370 missense probably benign 0.41
R4393:Msl2 UTSW 9 101101477 missense probably damaging 1.00
R4827:Msl2 UTSW 9 101102151 missense probably benign 0.00
R5290:Msl2 UTSW 9 101101407 unclassified probably null
R5567:Msl2 UTSW 9 101101737 missense possibly damaging 0.67
R5934:Msl2 UTSW 9 101101818 missense probably damaging 1.00
R5940:Msl2 UTSW 9 101101091 nonsense probably null
R6339:Msl2 UTSW 9 101101750 missense probably benign
R6736:Msl2 UTSW 9 101101002 missense probably damaging 0.99
R6950:Msl2 UTSW 9 101101975 missense possibly damaging 0.66
R6971:Msl2 UTSW 9 101100843 missense probably benign
R7022:Msl2 UTSW 9 101075282 missense possibly damaging 0.91
R7408:Msl2 UTSW 9 101102117 missense probably benign 0.08
R7955:Msl2 UTSW 9 101102155 missense possibly damaging 0.69
R8069:Msl2 UTSW 9 101100960 missense probably benign
R8281:Msl2 UTSW 9 101101695 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGCATTTGCGGTGCCAGAAAAG -3'
(R):5'- GCATTTGAAGGCAGCACAAAGTCTC -3'

Sequencing Primer
(F):5'- TTGCTGTGCGTAACGCAA -3'
(R):5'- GCGCAATCTTTATGGACTGAC -3'
Posted On2014-01-29