Incidental Mutation 'R1288:Fbxw28'
ID150675
Institutional Source Beutler Lab
Gene Symbol Fbxw28
Ensembl Gene ENSMUSG00000054087
Gene NameF-box and WD-40 domain protein 28
SynonymsGm9337
MMRRC Submission 039354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1288 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109322886-109339659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109337293 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 165 (I165T)
Ref Sequence ENSEMBL: ENSMUSP00000143357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112039] [ENSMUST00000112040] [ENSMUST00000196351] [ENSMUST00000200156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112039
AA Change: I129T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107670
Gene: ENSMUSG00000054087
AA Change: I129T

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 127 249 4e-9 SMART
Blast:WD40 136 175 3e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112040
AA Change: I129T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107671
Gene: ENSMUSG00000054087
AA Change: I129T

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 127 249 4e-9 SMART
Blast:WD40 136 175 4e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000196351
AA Change: I165T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143357
Gene: ENSMUSG00000054087
AA Change: I165T

DomainStartEndE-ValueType
FBOX 5 45 2e-8 SMART
SCOP:d1aym1_ 54 102 2e-3 SMART
Blast:WD40 172 211 5e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000200156
AA Change: I129T

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143361
Gene: ENSMUSG00000054087
AA Change: I129T

DomainStartEndE-ValueType
FBOX 5 45 2e-8 SMART
SCOP:d1tbga_ 127 208 2e-3 SMART
Blast:WD40 136 175 4e-6 BLAST
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A T 5: 129,129,007 D247V probably damaging Het
Ano5 A T 7: 51,546,872 S184C probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Atxn3 C T 12: 101,942,178 probably null Het
BC005537 A T 13: 24,804,900 E54V probably damaging Het
Ccdc150 A T 1: 54,364,458 E881V probably damaging Het
Cep126 A T 9: 8,112,181 N130K probably benign Het
Enoph1 A G 5: 100,040,279 T21A possibly damaging Het
Lrp12 A T 15: 39,878,403 N305K probably damaging Het
Msl2 A G 9: 101,102,109 T561A probably benign Het
Mup21 G T 4: 62,150,697 A19E probably benign Het
Myh13 T C 11: 67,353,718 I1027T probably benign Het
Nkg7 A G 7: 43,437,662 probably null Het
Nme8 A G 13: 19,674,449 V73A possibly damaging Het
Olfr1135 G A 2: 87,671,572 A265V probably benign Het
Olfr123 T A 17: 37,795,693 L83Q probably damaging Het
Olfr138 A G 17: 38,275,223 T151A probably benign Het
Olfr68 A T 7: 103,778,042 L101Q possibly damaging Het
Olfr822 A G 10: 130,075,285 N292D probably damaging Het
Rapgef3 C A 15: 97,759,342 S267I probably benign Het
Trhde T A 10: 114,801,290 D4V probably benign Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp40 T A 17: 23,182,162 I36L probably benign Het
Other mutations in Fbxw28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01883:Fbxw28 APN 9 109328325 missense probably benign 0.05
IGL02080:Fbxw28 APN 9 109339573 missense probably damaging 1.00
IGL02313:Fbxw28 APN 9 109337352 missense possibly damaging 0.76
R0029:Fbxw28 UTSW 9 109328289 missense probably damaging 1.00
R0038:Fbxw28 UTSW 9 109338540 missense probably damaging 1.00
R0058:Fbxw28 UTSW 9 109328211 missense probably benign 0.22
R1898:Fbxw28 UTSW 9 109323384 missense probably benign 0.32
R2065:Fbxw28 UTSW 9 109328224 missense probably benign 0.03
R2117:Fbxw28 UTSW 9 109330917 missense probably benign 0.04
R3410:Fbxw28 UTSW 9 109338404 missense possibly damaging 0.55
R3812:Fbxw28 UTSW 9 109338530 missense possibly damaging 0.83
R4400:Fbxw28 UTSW 9 109328310 missense probably damaging 1.00
R4840:Fbxw28 UTSW 9 109339534 missense probably null 1.00
R4899:Fbxw28 UTSW 9 109330853 missense probably damaging 0.99
R5129:Fbxw28 UTSW 9 109326603 missense probably damaging 1.00
R5613:Fbxw28 UTSW 9 109338533 missense probably benign 0.02
R5777:Fbxw28 UTSW 9 109338536 missense probably damaging 0.98
R6029:Fbxw28 UTSW 9 109329425 missense probably damaging 1.00
R6235:Fbxw28 UTSW 9 109326190 missense probably damaging 1.00
R6367:Fbxw28 UTSW 9 109339531 critical splice donor site probably null
R6820:Fbxw28 UTSW 9 109338425 missense probably damaging 1.00
R6968:Fbxw28 UTSW 9 109330788 missense probably benign 0.00
R7763:Fbxw28 UTSW 9 109326633 missense probably damaging 0.96
RF024:Fbxw28 UTSW 9 109338526 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTTTGAACACTGACAAGCCCTGC -3'
(R):5'- AGTGTGCATGGCTGCCTCTTTC -3'

Sequencing Primer
(F):5'- gcaccctctttgacctctac -3'
(R):5'- ATGCCTACTTCGTGGCAGAG -3'
Posted On2014-01-29